Un médecin explique que le coronavirus n’est pas ce que l’on croit.

Vous allez peut-être trouver que j’insiste beaucoup sur le faux concept de virus. Mais comme constaté à travers mes autres articles sur ce sujet, je ne peux cacher que je suis assez convaincu de cette approche.
Voici cette fois une vidéo courte, percutante et sous-titrée en français dans laquelle le Dr Cowan explique l’origine de cette maladie appelée C0VlD.

https://odysee.com/@SEMINERIOSalvatore:5/mediaport-un-m%C3%A9decin-explique-pourquoi-le-coronavirus-nest-PAS:5

En complément vous trouverez ci-dessous un lien de téléchargement vers le livre du Dr Cowan Le Mythe de la Contagion (disponible librement sur le net en anglais) et que j’ai traduit en français pour son intérêt.

Le C0VlD n’existe pas: la preuve

« Stanford, Cornell et cinq autres laboratoires universitaires californiens « ont trouvé le C19 imaginaire, fictif, pas un virus et poursuivent le CDC pour fraude concernant le Covid », Rob Oswald, docteur en virologie et immunologie de l’université de Cornell :

« Ce à quoi nous avons affaire est donc juste une autre souche de grippe comme chaque année, le C19 n’existe pas et est fictif. Je crois que la Chine et les mondialistes ont orchestré ce canular de COVID (la grippe déguisée en nouveau virus) pour instaurer une tyrannie mondiale et un État de surveillance totalitaire de la police mondiale, et ce complot incluait une fraude électorale massive ».

« J’ai un doctorat en virologie et immunologie. Je suis un scientifique de laboratoire clinique et j’ai testé 1500 échantillons de C19 « supposés » positifs collectés ici en Californie du Sud. Lorsque mon équipe de laboratoire et moi-même avons effectué les tests selon les postulats de Koch et l’observation au MEB (microscope électronique à balayage), nous n’avons trouvé AUCUN Covid dans ces 1500 échantillons. Ce que nous avons constaté, c’est que les 1500 échantillons étaient pour la plupart des cas de grippe A et certains des cas de grippe B, mais pas un seul cas de Covid, et nous n’avons pas utilisé le test PCR B.S. »

« Nous avons ensuite envoyé le reste des échantillons à Stanford, Cornell et à quelques laboratoires de l’Université de Californie et ils ont trouvé les mêmes résultats que nous, PAS DE COVID. Ils ont trouvé la grippe A et B. Nous avons alors tous parlé au CDC et demandé des échantillons viables de COVID, que le CDC a dit ne pas pouvoir fournir car il n’avait pas d’échantillons ».

« Nous sommes maintenant parvenus à la ferme conclusion, grâce à toutes nos recherches et à notre travail en laboratoire, que le C19 était imaginaire et fictif. La grippe s’appelait Covid et la plupart des 225 000 personnes décédées l’ont été à la suite de comorbidités telles que des maladies cardiaques, le cancer, le diabète, l’emphysème, etc. Je n’ai pas encore trouvé un seul échantillon viable de C19 avec lequel travailler ».

« Nous, les sept universités qui avons effectué les tests de laboratoire sur ces 1500 échantillons, poursuivons maintenant le CDC pour fraude au C19. Le CDC ne nous a toujours pas envoyé un seul échantillon viable, isolé et purifié de C19. S’ils ne peuvent ou ne veulent pas nous envoyer un échantillon viable, je dis qu’il n’y a pas de C19, il est fictif. Les quatre documents de recherche qui décrivent les extraits génomiques du virus C19 n’ont jamais réussi à isoler et à purifier les échantillons. Les quatre articles écrits sur le C19 ne décrivent que de petits morceaux d’ARN qui ne faisaient que 37 à 40 paires de bases, ce qui n’est PAS UN VIRUS. Un génome viral est généralement constitué de 30 000 à 40 000 paires de bases ».

« Avec un taux d’infection aussi élevé que celui du Covid, comment se fait-il que personne, dans aucun laboratoire du monde, n’ait jamais isolé et purifié ce virus dans son intégralité ? C’est parce qu’ils n’ont jamais vraiment trouvé le virus, tout ce qu’ils ont trouvé, ce sont des petits morceaux d’ARN qui n’ont jamais été identifiés comme le virus de toute façon ».

En complément vidéo du Dr Kaufman (en anglais) expliquant les protocoles de Koch et Rivers pour prouver l’existence de virus pathogènes.

Autre complément: des scientifiques ne trouvent pas de virus dans 1500 échantillons considérés comme positifs. Cela est confirmé par d’autres collègues. De plus les organismes comme le CDC … avouent n’être pas en mesure de dispose d’échantillons isolés du virus !

Lien sur Bitchute: https://www.bitchute.com/video/9a2mmdnr3jB5/

Ce vakx1 est-il nécessaire, sécure et efficient? Fiche d’information par et pour médecins & et les patients intéressés

Traduction d’une fiche d’information complète émise par Preventie Vakxinatieschade

Avec le soutien de: Dr. Anne De Clerck, Dr. Bart Lambert, Dr. Dirk Bultinck, Dr. Eric Beeth, Dr. Gaëtane Beeckaert, Dr. Geert Verhelst, Dr. Hilde De Smet, Dr. Jean-Luc Vanderlinden, Dr. Johan Denis, Dr. Leo Van den Bossche, Dr. Pieter Lanoye, Dr. Steven Devos.
Remarquable :
De nombreux médecins (généralistes) flamands ne veulent pas d’un vakx1 Covid-19 pour eux-mêmes.
Différentes enquêtes parlent de 9 à 30 %1 2 3.
Quelles pourraient être leurs raisons ?


Voici quelques faits, le meilleur remède contre les fausses nouvelles. N’hésitez pas de vérifier vous-même les liens et les autres sources à la fin de cette fiche.

1. Le Covid-19 n’est en moyenne pas très mortel. La plupart des personnes infectées ne présentent aucun symptôme4. Même les personnes au-dessus de 85 ans survivent à l’infection dans plus de 90 % des cas5. Les personnes de moins de 70 ans ont un taux de survie de 99,95 %. En effet, le taux de mortalité par infection est de 0,23% dans l’ensemble et de 0,05% pour les personnes de moins de 70 ans.6

2. Pour réduire le risque de corona (sévère), un système immunitaire robuste est de la plus haute importance. Tout le monde, et en particulier les patients vulnérables (les personnes âgées et les personnes souffrant de troubles sous-jacents), peut soutenir son système immunitaire en adoptant un mode de vie sain : repos, exercice, contacts sociaux, alimentation saine, peu de stress ou d’anxiété7 8 … Des études récentes confirment que la supplémentation en vitamine D peut faire une énorme différence dans le risque d’être atteint de corona et les complications corona et de mortalité : « Nous observons une corrélation très significative entre la prévalence de la carence en vitamine D et l’incidence de Covid-19 »9 10 11 12 13. Les vitamines A et C, le zinc14 15 16 et le sélénium sont également essentiels pour une bonne immunité.17 18

3. En cas de diagnostic de Covid-19, un médecin généraliste peut – contrairement à la croyance populaire – faire beaucoup pour éviter une hospitalisation. L’équipe de Docs4OpenDebate, soutenue par quelques 700 médecins, en donne un aperçu19 , tout comme notre site web20. L’hydroxychloroquine (HCQ) est simplement disponible en pharmacie et peut être utilisée (malgré une couverture médiatique négative) avec grand succès dans les premiers stades de la maladie, comme le prouvent et l’expliquent en détail de nombreuses études (posologie et combinaison avec le zinc et l’azithromycine)21 22 23 24. Il en va de même pour l’Ivermectine25. En mars, la virologiste Anne-Mieke Vandamme (KU Leuven) a même recommandé de fortes doses de vitamine C pour vaincre la maladie26. À l’hôpital, l’administration d’une très forte dose de vitamine D réduit le risque d’admission en soins intensifs de 96 %.27

4. Peu connu mais très important : une grande partie de la population possède déjà une immunité naturelle contre le Covid-19. Ceci est dû au contact avec le Sars-CoV-2 (le virus qui déclenche le Covid-19), ou avec un autre type de coronavirus des dernières années (beaucoup de rhumes sont causés par des coronavirus28, ainsi que par la maladie du SARS de 2003) : c’est ce qu’on appelle « l’immunité croisée ». Cette protection ne repose pas sur des anticorps mais sur l’immunité cellulaire (via les cellules à mémoire T), qui reconnaît les anciens agents infectieux même après de nombreuses années, contrairement aux anticorps qui ne durent que quelques années au plus (ou parfois quelques mois)29 30 31. 30 31. On estime que 70 à 85 % de la population est déjà protégée contre le SRAS-CoV-2 de cette manière32, soit bien plus que les 14 % qui auraient des anticorps33.Ceci fait de l’immunité de groupe un fait. Pour ce groupe la vakxination n’est donc plus nécessaire34.

5. Ceux qui reçoivent le vakx1 peuvent encore transmettre le virus. C’est ce que disent les fabricants35, les chercheurs36, les experts gouvernementaux37 et même notre Premier ministre38. C’est parce que le vakx1 ne protège pas les muqueuses des voies respiratoires, de sorte que la personne vakxinée peut continuer à propager le virus39La vakxination par « solidarité » (pour protéger les autres) n’a donc aucun sens.

6. Efficacité des vakx1 : le marketing de Pfizer qualifie son vakx1 « d’efficace à 95 % », mais ce chiffre est très trompeur : il ne fait référence qu’au nombre total de cas confirmés de Covid-19 et calcule la réduction du risque relatif. Le vakx1 aide-t-il vraiment à prévenir une atteinte du Covid-19 grave? Faites le calcul avec nous :

% = risque absolu ; ( ) = nombre de personnesvakx1Placébovakx1 avantage/désavantage
Risque de Covid-19 non grave0,04% (8)0,88% (162)0,84% moins de risque
Risque de Covid-19 grave0,006% (1)0,016% (3)0,01% moins de risque
Risque de réactions graves au vakx11,1% (240)0,6% (139)0,50% risque plus élevé

Selon ces données issues de l’étude du fabricant Pfizer lui-même40 41, leur vakx1 réduit de 0,01% le risque de Covid-19 grave. Il faudrait alors vakxiner environ 10 000 personnes pour prévenir un seul cas. Mais en réalité, ces chiffres sont trop faibles pour permettre de tirer des conclusions sensées (1 contre 3 cas). Ce qui est significatif, c’est que, sur la base des mêmes chiffres de Pfizer, on peut s’attendre à environ 50 effets secondaires graves du vakx1 sur 10 000 personnes vakxinées, soit environ 55 000 sur l’ensemble de la population belge. 55.000 sur l’ensemble de la population belge. La réalité est probablement encore moins rose, car l’étude est sous le feu des critiques sur de nombreux points :

  • Les sujets n’étaient pas représentatifs pour la population : les personnes en mauvaise santé (maladie chronique instable, déficience immunitaire) étaient exclues, ainsi que les personnes qui avaient déjà des anticorps ; le groupe d’étude comprenait également peu de personnes au-dessus des 75 ans.
  • Le nombre de cas de Covid-19 recensés ne tenait pas compte des 3 410 cas de Covid-19 « suspects mais non confirmés » : 1 594 dans le groupe de vakxination, 1 816 dans le groupe placébo. Si vous les incluez, l’efficacité s’avère encore beaucoup plus faible : une réduction du risque relatif d’à peine 29%, en principe trop faible pour une approbation42.
  • Alors que chez Moderna, le comité qui a dû établir les cas de Covid-19 était composé d’experts indépendants43 , il s’agissait, dans ce cas, d’employés de Pfizer elle-même44. Et ainsi de suite45 46.

7. Ce qui nous amène aux dégâts causés par la vakxination contre le Covid-19.

  • « Alerte en Norvège : 23 personnes meurent après avoir reçu le vakx1 Pfizer ». Les autorités sanitaires norvégiennes l’ont signalé le 15-1-2021. Ils ont averti que chez les personnes âgées et vulnérables, même des effets secondaires relativement légers peuvent être mortels.47 48 49 50.
  • Un document du CDC daté du 19-12-202051 mentionnait déjà 3 150 événements indésirables en cinq jours qui « empêchent le travail ou le fonctionnement normal, et nécessitent des soins médicaux » : sur 112 807 personnes, cela représente 2,79%. Le système de notification VAERS aux États-Unis a enregistré 40 433 « événements indésirables » à la suite de la vakxination Covid-1952 entre le 28 décembre et le 1er janvier, dont des cas graves53. Plusieurs décès ont déjà été signalés dans le monde entier.54 55 56 57 58 59.
  • Les réactions allergiques, y compris l’anaphylaxie (choc mettant la vie en danger), sont importantes : voir le document du CDC mentionné ci-dessus (six cas en cinq jours, soit beaucoup plus qu’avec les vakx1 classiques) et la brochure de l’EMA60.  Suspect est entre autres l’ingrédient PEG (polyéthylène glycol), utilisé ici pour la première fois dans des vakx1 mais déjà présent dans de nombreux médicaments et produits ménagers, ce qui a rendu certaines personnes hypersensibles61 62 63 64. Le CDC et l’EMA considèrent l’hypersensibilité au PEG ou à d’autres ingrédients comme une contre-indication à la vakxination contre le Covid-19.
  • Les effets secondaires à long terme sont de toute façon encore inconnus. En particulier, de nombreux problèmes auto-immuns et neurologiques surviennent souvent plus tard. C’est pourquoi l’approbation européenne de Pfizer et de Moderna est provisoire et les fabricants ont eu deux ans pour rendre compte plus en détail de la sécurité (la phase 3 de leurs essais cliniques est toujours en cours)65. Dans l’intervalle, ces fabricants ont déjà obtenu une exemption légale de responsabilité pour les « effets secondaires inattendus ».66
  • Qu’en est-il de la sécurité quant à la grossesse et l’allaitement ? Dans une pétition adressée à l’EMA, le Dr Wodarg, soutenu par l’ancien vice-président de Pfizer, le Dr Yeadon, a exprimé sa crainte que les anticorps aux protéines de pointe du Sars-CoV-2 puissent également attaquer la syncitine-1, nécessaire à la grossesse, et ainsi rendre les femmes vakxinées infertiles67. Le dépliant provisoire britannique (daté du 10-12-2020) mettait en garde : « Ne pas vakxiner si vous êtes enceinte ou si vous allaitez. Évitez la grossesse pendant au moins deux mois après la vakxination ».68
  • Un risque établi de longue date avec les vakx1 contre les coronavirus69 est la « facilitation de l’infection par des anticorps » (ADE) : une personne vakxinée deviendra alors plus gravement malade en cas d’infection ultérieure par le virus que sans vakxination. Des vakx1 tels que celui contre le SRAS (SRAS-CoV-1) n’ont jamais été approuvés pour cette raison : chez les souris vaccinées, le contact ultérieur avec le coronavirus naturel a provoqué une tempête de cytokines et donc une « maladie pulmonaire immuno-pathologique »70. Des études récentes confirment explicitement : « Le risque d’ADE dans les vakx1 Covid-19- n’est pas théorique et convaincant. (…) Recevoir le vakx1 Covid-19 pourrait convertir un sujet atteint d’une maladie bénigne, en un sujet grièvement malade ».71 Quelles pourraient en être les conséquences en cas de vakxination de masse ?

8. Les vakx1 Covid-19 de Pfizer et Moderna utilisent la technologie de l’ARNm. Cela implique l’insertion du code génétique d’un morceau du virus. Qu’est-ce que cela signifie pour le génome humain (ADN) ? Des recherches récentes (décembre 2020) suggèrent que cet ARNm peut être incorporé dans notre propre ADN via la transcriptase inverse et l’intégrase72 73. Les porteurs du VIH, en particulier, y seraient sensibles. Il s’agit d’une prépublication (pas d’examen par les pairs) mais cette étude donne toutes les raisons d’appliquer le principe de précaution. Le généticien moléculaire Christian Vélot (Université de Paris) est d’accord :« Pourquoi choisir une technologie inconnue et imprévisible? »74 Il développe les risques de cette technique d’ARNm, ainsi que ceux de la variante d’ADN recombinante, utilisant un adénovirus comme vecteur viral, utilisée par Oxford/AstraZeneca. Lorsqu’elle est utilisée à des fins thérapeutiques, cette thérapie génique a déjà provoqué une leucémie chez les enfants traités (comme chez les animaux de laboratoire)75. Une autre question qui se pose est, si ces techniques génétiques ne constituent pas la recette idéale pour les maladies auto-immunes : une réponse immunitaire est déclenchée contre les protéines produites par la cellule elle-même, ce qui fait que le système immunitaire pourrait alors attaquer les cellules saines76. D’autres fabricants utilisent des techniques plus conventionnelles, comme GSK, dont le vakx1 est attendu plus tard dans l’année.
9. De plus en plus d’experts indépendants expriment leur grande inquiétude. Une sélection :

  • Professor Sucharit Bhakdi, microbiologue allemand: « [Ces vakx1] sont des expériments sur des humains. »78 79
  • Professor Dr. Luc Montagnier, Prix de Nobel médecine : « Nous savons trop peu sur ces vakx1 , nous sommes des cobayes. »80
  • L’infectiologue français Eric Caumes: « Je n’ai jamais vu autant d’effets secondaires »81.
  • Professor Dr. Theo Schetters, immunologue et développeur de vakx1 : « La vakxination contre la corona n’est pas nécessaire et une vakxination des masses et extrêmement irresponsable vu les effets secondaires et les conséquences inconnus. »82
  • 10. Certains groupes de patients nécessitent une prudence particulière :(1) Ceux qui ont fait l’expérience de Covid-19 ont déjà développé une immunité à long terme, à la fois par le biais d’anticorps comme par les cellules T et B-mémoire. Ces dernières protègent pendant de nombreuses années (voir point 4), même après que les anticorps aient disparu depuis longtemps : ceci est confirmé par une étude récente (Science, 6-1-202183). Ça n’aide pas, ça ne fait pas mal ? En effet, outre les éventuels effets secondaires du vakx1, les personnes qui ont déjà des anticorps courent un risque supplémentaire lorsqu’elles sont vakxinées, appelé « hyperimmunité », qui entraîne des complications supplémentaires84. Le dépistage préalable des anticorps (et même des cellules T, ce qui est moins courant) peut éviter des vakxination inutiles. (2) Si une personne est déjà infectée, mais ne présente pas (encore) de symptômes – c’est-à-dire qu’elle est en « phase d’incubation » – la vakxination constitue un risque supplémentaire85. En cas de suspicion d’infection, il est préférable d’éviter la vakxination. C’est pourquoi les centres de soins résidentiels attendent souvent attendre deux semaines après le dernier foyer de corona pour vakxiner.86 87(3) Les enfants, et ce pour trois raisons :1 – Les enfants ne souffrent presque jamais sévèrement de Covid-19 et ne sont pas de grands propagateurs88.2 – Le vakx1, comme mentionné ci-dessus, n’empêche pas la propagation du virus.3 – Les effets secondaires peuvent frapper les enfants de manière très forte (mêmes doses pour un poids du corps inférieur).
COMMENT ÉVALUER LA SÉCURITÉ DES VAKX1S ?
• Presque tous les vakx1 actuels (bien sûr pas les vakx1 à ARNm Covid-19) contiennent de l’aluminium comme adjuvant : il n’y a absolument aucun consensus sur son innocuité. De nombreuses recherches suggèrent même que des plaintes graves, de type SFC, peuvent être attribuées à cet aluminium vaccinal89 90. En outre, des analyses indépendantes montrent que les vakx1 contiennent de nombreuses autres impuretés : toutes sortes de substances toxiques en quantités parfois bien supérieures aux valeurs limites, y compris de l’ADN animal ou humain complet91.
• Aussi incroyable que cela puisse paraître, les essais de vakx1 impliquent rarement une comparaison avec un vrai placébo, comme cela est en principe exigé pour tous les agents pharmaceutiques92 93. Par exemple, un vakx1 différent (!) est alors utilisé dans le groupe de contrôle94. Dans certains essais du vakx1 Covid-19, un vaccin anti-méningococcique a été utilisé comme « placébo »95.
• Les fabricants passent plus d’une fois sous silence les rapports d’effets secondaires graves. GSK, par exemple, l’a fait en 2014 avec les décès inattendus qui ont suivi l’administration d’Infanrix Hexa96 97.
• Une question importante est l’impact des vakxinations sur l’état de santé général des individus. De plus en plus de recherches sont menées dans ce domaine : un plus grand nombre de vakx1 n’entraîne pas nécessairement une meilleure santé générale, parfois au contraire98 99 100. Plus le nombre de vakx1 administrés simultanément est élevé, plus le risque d’hospitalisation ou de décès est important101. La commission d’enquête parlementaire italienne sur les maladies et les décès des soldats en mission sont également arrivés à cette conclusion en 2018 : Il vaut mieux éviter les vakx1 combinés et prendre au sérieux la surveillance à long terme des effets secondaires102.
• De nombreuses recherches et informations sont faussées par des influences financières. L’OMS est en grande partie financée, directement ou indirectement, par le secteur pharmaceutique103 104 105. Des experts fréquemment cités, tels que le vakxinologue Pierre Van Damme, ont des liens financiers avec l’industrie pharmaceutique (voir le document de l’EMA106).
• Qu’est-ce qu’une information fiable et qu’est-ce qu’une fausse nouvelle ? Pour le déterminer, il faut au moins avoir accès à toutes les sources d’information. L’OMS semble penser différemment : elle demande aux médias (sociaux) de filtrer toute voix critique sur un aspect de la vakxination en tant que « fausse nouvelle »107. Les chercheurs qui souhaitent publier des résultats défavorables sur certains vakx1 se heurtent très probablement à une opposition et à des formes de censure (voir quelques exemples dans le numéro de juin 2020 de De Prikkrant.108

LIRE PLUS SUR CORONA & vakxination ? Vous trouverez les références et hyperliens, tout comme le contenu des notes de fin de page ci-dessous ou dans la version électronique de cette fiche d’information : www.vaccinatieschade.be/content/corona-fact-sheet.
v.u. Preventie Vaccinatieschade vzw (Dr. Kris Gaublomme), Oude Baan 373, 3630 Maasmechelen

Imaginez si le virus n’avait jamais été détecté

John-TamnyJohn Tamny – 4 février 2021 Temps de lecture: 4 minutes

Parmi ceux qui ont regardé les verrouillages tragiques et inutiles se dérouler au cours des 11 derniers mois, une question fréquente s’est posée: et si le coronavirus s’était propagé, mais n’avait jamais été diagnostiqué ou détecté? La vie aurait-elle été différente sans la découverte de ce qui a provoqué une panique mondiale massive parmi les politiciens?

Ce n’est pas une question déraisonnable. Vraiment, demandez-vous ce que les politiciens et les médias acharnés auraient fait il y a 100 ans si le virus s’était révélé. Étant donné que le travail était une destination réaliste pour tout le monde, il n’y avait aucun moyen qu’il y ait eu des verrouillages. Les gens se seraient révoltés.

Quant aux décès, l’espérance de vie était déjà relativement faible dans les années 1920. Cela est pertinent quand on se souvient que le coronavirus dans un sens de la mort a été largement associé aux maisons de retraite. Ces maisons n’étaient pas très courantes il y a cent ans, et elles ne l’étaient pas principalement parce que la pneumonie, la tuberculose et d’autres grands tueurs avaient tendance à nous atteindre bien avant que nous ayons atteint la vieillesse. Traduit, il n’y avait probablement pas assez de personnes âgées dans les années 1920 pour que le virus ait eu un impact mortel. En raison d’un manque de personnes âgées, le virus n’aurait peut-être pas été découvert en premier lieu. Pensez-y.

Comme cette colonne l’a longtemps indiqué, le coronavirus est le virus d’un homme riche. Ce n’est pas seulement que les riches et généralement aisés avaient des emplois portables qui ont surtout survécu aux verrouillages stupides. Que ce n’est que dans un pays et un monde où les personnes âgées sont vraiment âgées que le virus aurait une association notable avec la mort. Les gens vivent plus longtemps aujourd’hui, et ils le font parce que les progrès majeurs de la santé nés de la création de richesse ont rendu la vie plus longue possible. Nous n’aurions pas remarqué ce virus il y a 100 ans. Nous n’étions pas assez riches.Ce qui nous amène à un article récent de Leah Rosenbaum à  Forbes. Elle a écrit à propos d’un article des NIH indiquant que près de 17 millions de cas de coronavirus ont été dénombrés l’été dernier. Selon Rosenbaum, cette découverte «suggère que la pandémie était beaucoup plus répandue aux États-Unis qu’on ne le pensait auparavant». Oui bien sur.

De peur que les lecteurs n’oublient, le virus a commencé à se propager à l’automne 2019, sinon plus tôt. On pense généralement que l’épicentre était la Chine, et les vols entre les États-Unis et la Chine, ainsi que les vols de la Chine vers le reste du monde, étaient plutôt nombreux jusqu’en 2020. 

Compte tenu de la connexion entre la Chine et le reste du monde, la logique veut que le virus infecte les gens dans le monde bien avant que les politiciens ne paniquent. Dans ce cas, il n’est pas surprenant que les estimations faites sur le nombre d’Américains infectés aient toujours été bien trop faibles. On dit que le virus se propage facilement, encore plus facilement que la grippe, et il a recommencé à se répandre dans le monde en 2019.

Sa propagation rapide est remarquable, car la vie a continué à travers le monde. Comme les derniers mois de 2019 le montrent clairement, les gens vivaient avec le virus. Ce qui est le plus mortel pour les personnes âgées n’est pas très remarqué par ceux qui ne sont pas vieux. Un virus à propagation rapide n’était apparemment pas un facteur important jusqu’à ce que les politiciens en fassent inutilement un.

En effet, un virus le plus mortel pour les très vieux a des qualités douces lorsqu’il est rencontré par des personnes plus jeunes. S’ils sont infectés, trop nombreux ne trouvent pas les symptômes suffisamment inquiétants pour qu’ils soient réellement testés.

C’est ce que semble indiquer le rapport de Rosenbaum. L’étude des NIH a couvert les tests sanguins de 11000 Américains qui n’avaient pas été diagnostiqués auparavant avec Covid-19. Parmi les participants, 4,6% avaient des anticorps Covid-19, mais leur phase d’infection réelle ne leur était jamais apparente. C’est ce que Holman Jenkins a toujours souligné. Le nombre de personnes infectées a toujours largement dépassé les estimations, précisément parce que les symptômes de l’infection ne valaient pas la peine d’aller chez le médecin pour la grande majorité des personnes infectées.

En regardant à nouveau 100 ans en arrière, demandez-vous combien auraient alors consulté un médecin si quelque chose ressemblant au coronavirus s’était propagé. Ou mieux encore, demandez-vous combien auraient été testés aux États-Unis qui étaient un peu plus pauvres qu’aujourd’hui. Les questions se répondent. Le virus se serait propagé rapidement au sein d’une population plus jeune dans les années 1920, et les personnes infectées auraient développé une immunité.

D’après le rapport de Rosenbaum, il n’est pas déraisonnable de supposer que bien plus d’Américains sont immunisés contre le virus qu’on ne le sait, et que la meilleure approche depuis toujours aurait été la liberté. Laissez les gens vivre leur vie. Plus important encore, laissez-les être infectés. Pendant des siècles, ils ont poursuivi l’immunité en – halètement – s’infectant les uns les autres.

Alors, que se serait-il passé si le coronavirus n’était pas détecté? Nous ne le saurons jamais, mais il n’est pas irréaliste de conclure que nous avons une idée. Le virus n’a pas soudainement commencé à se propager en mars 2020 juste parce que les politiciens l’ont décidé. Le début le plus probable est 2019. Début 2020 aussi. La vie était plutôt normale, car un virus faisait alors le tour du monde.

Les politiciens l’ont rendu anormal. N’oublions jamais le carnage écœurant qu’ils peuvent créer lorsqu’ils trouvent des raisons de «faire quelque chose».

Réimprimé à partir de RealClearMarkets

Le fantôme du virus: à la recherche du Sars-Cov-2

Pour ceux qui veulent encore creuser la question de l’inexistence réelle du virus …

Traduction de l’article paru dans Off-Guardian du 31/1/21

Torsten Engelbrecht, Dr Stefano Scoglio et Konstantin Demeter

Même l’Institut Robert Koch et d’autres autorités sanitaires ne peuvent pas présenter de preuve décisive qu’un nouveau virus nommé SARS-CoV-2 nous hante. Cela seul transforme les discussions sur les mutations virales dangereuses en alarmistes irresponsables et les soi-disant tests PCR SARS-CoV-2 en une entreprise sans valeur.

Dans une demande d’étude qui montre l’isolement et la purification complets des particules prétendument SRAS-CoV-2, Michael Laue de l’un des représentants les plus importants au monde de la «panicdémique» COVID-19, l’Institut allemand Robert Koch (RKI ), a répondu que [ 1 ]:

Je ne connais pas de papier purifiant le SRAS-CoV-2 isolé.

C’est une déclaration plus que remarquable, elle admet un échec complet. Cette concession est conforme aux déclarations que nous avons présentées dans notre article «Les tests de PCR COVID-19 sont scientifiquement dénués de sens» qu’OffGuardian a publié le 27 juin 2020 – un article qui était le premier au monde décrivant en détail pourquoi la PCR SARS-CoV-2 les tests sont sans valeur pour le diagnostic d’une infection virale.

L’un des points cruciaux de cette analyse était que les études prétendant avoir montré que le SRAS-CoV-2 est un virus nouveau et potentiellement mortel n’ont pas le droit de le revendiquer, en particulier parce que les études revendiquant l ‘«isolement» du soi-disant SRAS-CoV-2 n’a en fait pas réussi à isoler (purifier) ​​les particules dites être le nouveau virus.

Ceci est confirmé par les réponses des scientifiques des études respectives à notre enquête, qui sont présentées dans un tableau de notre article – parmi lesquelles l’article le plus important au monde en ce qui concerne l’affirmation d’avoir détecté le SRAS-CoV-2 (par Zhu et al.), publié dans le New England Journal of Medicine le 20 février 2020 , et maintenant même le RKI.

Soit dit en passant, nous sommes en possession d’une autre réponse confirmative des auteurs [ 2 ] d’une étude australienne .

RECHERCHÉ, EN VAIN: VIRUS SRAS-COV-2

De plus, Christine Massey, une ancienne biostatisticienne canadienne dans le domaine de la recherche sur le cancer, et un de ses collègues en Nouvelle-Zélande, Michael Speth, ainsi que plusieurs personnes dans le monde (dont la plupart préfèrent rester anonymes) ont soumis au Freedom of Information des demandes adressées à des dizaines d’établissements sanitaires et scientifiques et à une poignée de bureaux politiques à travers le monde.

Ils recherchent des dossiers décrivant l’isolement d’un virus SRAS-COV-2 à partir de tout échantillon non altéré prélevé sur un patient malade.

Mais les 46 institutions / bureaux qui ont répondu n’ont absolument pas fourni ou cité aucun document décrivant l’isolement du «SRAS-COV-2»; et le ministère allemand de la Santé a complètement ignoré leur demande d’accès à l’information .

L’entrepreneur allemand Samuel Eckert a demandé aux autorités sanitaires de diverses villes telles que München (Munich), Düsseldorf et Zurich une étude prouvant l’isolement complet et la purification du soi-disant SRAS-CoV-2. Il ne l’a pas encore obtenu .

RÉCOMPENSES POUR PREUVE D’ISOLEMENT ET DE CAUSALITÉ

Samuel Eckert a même offert 230 000 € à Christian Drosten s’il peut présenter des passages de textes de publications qui prouvent scientifiquement le processus d’isolement du SRAS-CoV-2 et de sa substance génétique. La date limite (31 décembre 2020) est passée sans que Drosten ne réponde à Eckert .

Et une autre date limite est passée le 31 décembre sans soumission de la documentation souhaitée. Dans ce cas, le journaliste allemand Hans Tolzin a offert une récompense de 100 000 € pour une publication scientifique décrivant une tentative d’infection réussie avec le SARS-CoV-2 spécifique entraînant de manière fiable une maladie respiratoire chez les sujets de test.

LA VARIATION DE LA TAILLE DES PARTICULES RÉDUIT ÉGALEMENT L’HYPOTHÈSE VIRALE À L’ABSURDe

Récemment, nous sommes effrayés par de nouvelles souches présumées de «SRAS-CoV-2», mais cette affirmation n’est pas fondée sur une science solide.

Tout d’abord, vous ne pouvez pas déterminer une variante d’un virus si vous n’avez pas complètement isolé l’original.

Deuxièmement, il existe déjà des dizaines de milliers de nouvelles souches supposées , «trouvées» depuis l’hiver dernier dans le monde entier. En fait, la banque de données virales GISAID compte désormais plus de 452 000 séquences génétiques différentes qui prétendent représenter une variante du SRAS-Cov2 .

Donc, prétendre qu’il y a maintenant soudainement de «nouvelles souches» est de la pure folie, même d’un point de vue orthodoxe, parce que de ce point de vue, les virus mutent constamment. Ainsi, ils peuvent constamment proclamer avoir trouvé de nouvelles souches, perpétuant la peur.

Une telle peur est d’autant plus absurde que l’on jette un coup d’œil aux micrographies électroniques imprimées dans les études pertinentes, qui montrent des particules censées représenter le SRAS-CoV-2. Ces images révèlent que ces particules varient extrêmement en taille. En fait, la bande passante varie de 60 à 140 nanomètres (nm) . Un virus qui a une telle variation de taille extrême ne peut pas réellement exister.

Par exemple, on peut dire des êtres humains qu’ils varient d’environ 1,50 mètre à 2,10 mètres, car il y a plusieurs individus de différentes hauteurs. Maintenant, dire que les virus dans leur ensemble vont de 60 à 140 nm – comme l’ont fait Zhu et al. – peut éventuellement avoir un sens; mais dire que les virions individuels du SRAS-Cov2 varient autant serait comme dire que John varie sa taille de 1,60 à 2 mètres selon les circonstances!

On pourrait répondre que les virus ne sont pas des individus humains, mais il est également vrai que, selon la virologie, chaque virus a une structure assez stable. Ainsi, avec SARS-Cov2, ils prennent des libertés de définition qui confirment en outre que tout sur ce virus spécifique est encore plus aléatoire que d’habitude. Et cette licence de définition illimitée a conduit au fait que l’entrée de Wikipédia sur le coronavirus a été modifiée, et rapporte maintenant que «chaque virion du SRAS-CoV-2 a un diamètre d’environ 50 à 200 nm» .

Ce serait comme dire que John varie sa taille de 1 à 4 mètres selon les circonstances!

Ce que l’on fait passer pour le SRAS-Cov2 sont en fait des particules de toutes sortes, comme le montrent également les images fournies par l’article mentionné par Zhu et al. Ci-dessous, la photo que Zhu et al. présent comme la photo du SRAS-Cov2:

Grâce à un mètre de taille d’écran (FreeRuler), les particules que les auteurs attribuent au SARS-CoV-2 peuvent être mesurées. Les particules agrandies de la photographie de gauche mesurent environ 100 nm chacune (sur une échelle de 100 nm). Mais dans l’image de droite, toutes les petites particules indiquées par des flèches comme SARS-CoV-2, mesurées à une échelle de 1 MicroM (1000 nm), ont des tailles totalement différentes.

Les flèches noires indiquent en fait des vésicules. En mesurant certaines de ces particules avec la règle, le résultat est que dans la vésicule centrale, la particule la plus élevée au centre mesure près de 52 nm, donc en dessous de la gamme proposée par Zhu et al (60 à 140 nm); la particule immédiatement à sa droite mesure un peu plus, environ 57,5 ​​nm, mais toujours en dessous de la limite; tandis que, presque au centre de la vésicule la plus basse, la plus grosse particule (flèche jaune) mesure environ 73,7 nm, s’inscrivant dans les larges marges de Zhu et al .; enfin, dans la vésicule inférieure gauche, la plus grosse particule mesure un bon 155,6 nm, c’est-à-dire bien au-dessus de la limite maximale définie par Zhu et al. (140 nm).

Il est probable que la correction apportée récemment sur Wikipédia visait précisément à couvrir ce problème.

Il y a d’autres indications fortes que les particules appelées SARS-CoV-2 peuvent en fait être des particules inoffensives ou même utiles, appelées «vésicules extracellulaires» (VE), qui ont des dimensions extrêmement variables (de 20 à 10 000 nm), mais qui pour la plupart vont de 20 nm à 200 nm, et qui comprennent, en tant que sous-catégorie, celle des «exosomes».

Les exosomes sont des particules produites par nos cellules et contiennent des acides nucléiques, des lipides et des protéines , et sont impliqués dans diverses activités utiles à notre corps, telles que le transport de molécules immunitaires et de cellules souches, ainsi que l’élimination des débris cataboliques de la cellule .

Les exosomes représentent peut-être la plus grande part des véhicules électriques et font l’objet de nombreuses études depuis plus de 50 ans. Bien que peu d’entre eux aient entendu parler de ces particules bénéfiques, la littérature scientifique à leur sujet est énorme, et uniquement sur PubMed, si l’on tape «exosome», plus de 14 000 études sont fournies! Nous ne pouvons pas entrer dans les détails sur les VE et les exosomes ici, mais il est important de souligner comment ils sont indiscernables des virus, et plusieurs scientifiques pensent qu’en réalité ce qui est défini comme un virus dangereux n’est rien d’autre qu’un exosome bénéfique.

Ceci est immédiatement visible au microscope électronique [ 3 ]:

Comme on peut le voir, le plus grand des exosomes est de la même taille et de la même structure que le prétendu SRAS-CoV-2, et il est donc plausible de croire que, dans la grande mer de particules contenues dans le surnageant du COVID-19 liquide broncho-alvéolaire du patient, ce qui est considéré comme le SRAS-CoV-2 n’est qu’un exosome.

POURQUOI LA PURIFICATION EST VITALE POUR PROUVER QUE SARS-COV-2 EXISTE

Donc, logiquement, si nous avons une culture avec d’innombrables particules extrêmement similaires, la purification des particules doit être la toute première étape afin de pouvoir véritablement définir les particules que l’on pense être des virus comme des virus (en plus de la purification des particules, bien sûr , il faut alors aussi déterminer parfaitement, par exemple, que les particules peuvent provoquer certaines maladies dans des conditions réelles et pas seulement de laboratoire).

Par conséquent, si aucune «purification» de particules n’a été faite nulle part, comment peut-on prétendre que l’ARN obtenu est un génome viral? Et comment un tel ARN peut-il alors être largement utilisé pour diagnostiquer une infection par un nouveau virus, que ce soit par des tests PCR ou autrement? Nous avons posé ces deux questions à de nombreux représentants du récit officiel corona dans le monde entier, mais personne n’a pu y répondre.

D’où, comme nous l’avons indiqué dans notre article précédent, le fait que les séquences de gènes d’ARN – que les scientifiques ont extraites d’échantillons de tissus préparés dans leurs études in vitro et auxquelles les tests SRAS-CoV-2 RT-PCR ont finalement été  » calibré ”- appartenir à un nouveau virus pathogène appelé SARS-CoV-2 est donc basé sur la foi seule, pas sur des faits.

Par conséquent, il ne peut être conclu que les séquences génétiques d’ARN «extraites» des échantillons de tissus préparés dans ces études, sur lesquels les tests PCR sont «calibrés», appartiennent à un virus spécifique, en l’occurrence le SARS-CoV-2.

Au lieu de cela, dans toutes les études prétendant avoir isolé et même testé le virus, quelque chose de très différent a été fait: les chercheurs ont prélevé des échantillons dans la gorge ou les poumons de patients, les ultracentrifugés (lancés à grande vitesse) pour séparer le plus gros / lourd du plus petit / molécules plus légères, puis a pris le surnageant, la partie supérieure du matériel centrifugé.

C’est ce qu’ils appellent «isoler», auquel ils appliquent ensuite la PCR. Mais ce surnageant contient toutes sortes de molécules, des milliards de micro et nanoparticules différentes, y compris les vésicules extracellulaires (VE) et les exosomes susmentionnés, qui sont produits par notre propre corps et sont souvent tout simplement indiscernables des virus:

De nos jours, il est presque impossible de séparer les VE et les virus au moyen de méthodes canoniques d’isolement des vésicules, telles que l’ultracentrifugation différentielle, car ils sont fréquemment co-granulés en raison de leur dimension similaire

… Comme il est dit dans l’étude The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses publiée en mai 2020 dans la revue Viruses .

Ainsi, les scientifiques «créent» le virus par PCR: vous prenez des amorces, c’est-à-dire. les séquences génétiques déjà existantes disponibles dans les banques génétiques, vous les modifiez sur la base d’un raisonnement purement hypothétique, et les mettez en contact avec le bouillon surnageant, jusqu’à ce qu’elles se fixent (s’annelent) à un certain ARN dans le bouillon; puis, grâce à l’enzyme Reverse Transcriptase, vous transformez l’ARN ainsi «pêché» en un ADN artificiel ou complémentaire (ADNc), qui peut alors, et seulement alors, être traité par PCR et multiplié par un certain nombre de cycles de PCR.

(Chaque cycle double la quantité d’ADN, mais plus le nombre de cycles nécessaires pour produire du matériel de «virus» détectable est élevé, plus la fiabilité de la PCR est faible, c’est-à-dire sa capacité à «obtenir» réellement quelque chose de significatif du surnageant. 25 cycles, le résultat a tendance à être dénué de sens, et tous les tests ou protocoles de PCR en circulation actuels utilisent toujours bien plus de 25 cycles, en fait généralement 35 à 45.)

Pour aggraver les choses, les amorces sont constituées de 18 à 24 bases (nucléotides) chacune; le virus SARS-Cov2 est censé être composé de 30 000 bases; si l’amorce ne représente que 0,08 pour cent du génome du virus . Cela rend encore moins possible de sélectionner le virus spécifique que vous recherchez sur un terrain aussi minuscule, et de plus dans une mer de milliards de particules très similaires.

Mais il y a plus. Comme le virus que vous recherchez est nouveau, il n’y a manifestement pas d’amorces génétiques prêtes à correspondre à la fraction spécifique du nouveau virus; donc vous prenez des amorces qui, selon vous , peuvent être plus proches de la structure du virus hypothétique , mais c’est une supposition, et lorsque vous appliquez les amorces au bouillon surnageant, vos amorces peuvent se fixer à l’un des milliards de molécules présentes, et vous n’ont aucune idée que ce que vous avez ainsi généré est le virus que vous recherchez . Il s’agit en fait d’une nouvelle création faite par des chercheurs, qui l’appellent alors SARS-CoV-2, mais il n’y a aucun lien avec le virus présumé «réel» responsable de la maladie.

LE «GÉNOME DU VIRUS» N’EST RIEN D’AUTRE QU’UN MODÈLE INFORMATIQUE

Le génome complet du virus SARS-CoV-2 n’a jamais été séquencé et a plutôt été «reconstitué» sur l’ordinateur. Le médecin californien Thomas Cowan a qualifié cela de «fraude scientifique». Et il n’est pas le seul de loin!

Cowan a écrit le 15 octobre 2020:

Cette semaine, ma collègue et amie Sally Fallon Morell a porté à mon attention un article étonnant publié par le CDC , publié en juin 2020. Le but de l’article était pour un groupe d’une vingtaine de virologues de décrire l’état de la science de l’isolement, purification et caractéristiques biologiques du nouveau virus SRAS-CoV-2, et de partager ces informations avec d’autres scientifiques pour leurs propres recherches.

Une lecture approfondie et attentive de cet article important révèle des résultats choquants.

La section de l’article avec le sous-titre «Whole Genome Sequencing» a montré que «plutôt que d’avoir isolé le virus et de séquencer le génome de bout en bout» , le CDC «a conçu 37 paires de PCR imbriquées couvrant le génome sur la base de la référence du coronavirus séquence (numéro d’accès GenBank NC045512).

Alors, on peut se demander comment ont-ils séquencé le virus, c’est-à-dire. l’analyser génétiquement?

Eh bien, ils n’ont pas analysé tout le génome, mais ont plutôt pris des séquences trouvées dans les cultures, ont affirmé sans preuve qu’elles appartenaient à un nouveau virus spécifique, puis ont fait une sorte de puzzle informatique génétique pour remplir le reste. « Ils utilisent la modélisation informatique pour créer essentiellement un génome à partir de rien », comme le dit le biologiste moléculaire Andrew Kaufman .

Il n’est peut-être pas surprenant que l’une des amorces du test développé par l’ Institut Pasteur corresponde exactement à une séquence du chromosome 8 du génome humain .

AUCUNE PREUVE QUE SARS-COV-2 PEUT VOLER

Soi-disant pour arrêter la propagation du prétendu nouveau virus, nous sommes obligés de pratiquer diverses formes de distanciation sociale et de porter des masques. Derrière cette approche se cache l’idée que les virus et en particulier le SRAS-CoV-2, supposé être responsable de la maladie respiratoire Covid-19, se transmettent par voie aérienne ou, comme on l’a dit plus souvent, par les gouttelettes nébulisées dans ceux qui toussent, éternuent ou, selon certains, parlent simplement.

Mais la vérité est que toutes ces théories sur la transmission du virus ne sont que des hypothèses qui n’ont jamais été prouvées.

La preuve en était absente depuis le début. Comme le rapporte Nature dans un article d’avril 2020 , les experts ne sont pas d’accord pour dire que le SRAS-CoV-2 est aéroporté et, selon l’OMS elle-même, «les preuves ne sont pas convaincantes».

Même d’un point de vue orthodoxe, les seules études dans lesquelles la transmission d’un coronavirus (et non le SRAS-Cov2) par voie aérienne a été au préalable «prouvée» ont été menées dans des hôpitaux et des maisons de retraite , dans des lieux qui seraient tous responsables types d’infections dues aux conditions d’hygiène.

Mais aucune étude n’a jamais prouvé qu’il y avait transmission de virus dans des environnements ouverts, ou dans des environnements fermés mais bien ventilés. Même à supposer qu’il y ait cette transmission par voie aérienne, il a été souligné que, pour que la «contagion» se produise, il est nécessaire que les personnes entre lesquelles se produit la transmission présumée soient en contact étroit pendant au moins 45 minutes .

Bref, toutes les mesures radicales de distanciation n’ont aucun fondement scientifique.

AUCUNE «INFECTION» ASYMPTOMATIQUE

Étant donné que la purification des particules est la condition préalable indispensable pour les étapes ultérieures, c’est-à-dire la preuve de causalité et «l’étalonnage» des tests, nous avons un test insignifiant sur le plan diagnostique et donc le mantra «test, test, test» par Tedros Adhanom Ghebreyesus de l’OMS, mentionné dans notre article du 27 juin, doit être qualifié de non scientifique et trompeur.

Cela est particulièrement vrai pour les tests de personnes sans symptômes. Dans ce contexte même une étude chinoise de Wuhan publiée dans Nature le 20 novembre 2020, dans laquelle près de 10 millions de personnes ont été testées et tous les cas positifs asymptomatiques, les cas re-positifs et leurs contacts étroits ont été isolés pendant au moins 2 semaines jusqu’à la PCR résultat négatif, a révélé que:

Tous les contacts étroits des cas positifs asymptomatiques se sont révélés négatifs, ce qui indique que les cas positifs asymptomatiques détectés dans cette étude étaient peu susceptibles d’être infectieux.

Même le British Medical Journal orthodoxe s’est récemment joint à la critique.

Peu avant Noël, le magazine scientifique a publié l’article « COVID-19: les tests de masse sont inexacts et donnent un faux sentiment de sécurité, admet le ministre » expliquant comment les tests déployés dans certaines régions du Royaume-Uni ne sont tout simplement pas précis pour les personnes asymptomatiques arguant qu’il ne peut pas déterminer avec précision si l’un est positif ou négatif, comme l’écrit Collective Evolution . (L’OMS elle-même l’a depuis admis Deux fois )

Déjà quelques semaines auparavant, vous pouviez lire dans The BMJ que :

Les tests de masse pour COVID-19 est un désordre non évalué, sous-conçu et coûteux,

Et:

Le dépistage du COVID-19 dans la population en bonne santé est d’une valeur inconnue, mais est en cours d’introduction à l’échelle nationale

Et que:

«La riposte du Royaume-Uni à la pandémie repose trop largement sur des scientifiques et d’autres personnes nommées par le gouvernement aux intérêts concurrents inquiétants, y compris des participations dans des sociétés qui fabriquent des tests de diagnostic, des traitements et des vaccins covid-19

En dehors de cela, l’avocat Reiner Füllmich, membre de la commission d’enquête extra-parlementaire allemande «Stiftung Corona Ausschuss», a déclaré que Stefan Hockertz, professeur de pharmacologie et de toxicologie, lui avait dit qu’aucune preuve scientifique n’avait été trouvée pour une infection asymptomatique .

Lorsqu’on lui a posé la question, l’Institut Robert Koch n’a pas été en mesure de nous envoyer une seule étude démontrant que (a) les personnes asymptomatiques «positives» rendaient quelqu’un d’autre malade (pas seulement «positives»), que (b) les personnes «positives» présentant des symptômes de maladie quelqu’un d’autre malade (pas seulement «positif»), et que (c) toute personne qui a été testée «positive» pour le SRAS-CoV-2 a rendu une autre personne «positive». [ 4 ]

« SI VOUS NE TESTIEZ PLUS, LE CORONA DISPARAÎTRAIT »

Même en mai, une publication majeure telle que le Journal of the American Medical Association a déclaré qu’un résultat de PCR «positif» n’indique pas nécessairement la présence d’un virus viable », tandis qu’une étude récente dans The Lancet indique que « la détection d’ARN ne peut pas être utilisée pour déduire la contagiosité. « 

Dans ce contexte, on ne peut qu’être d’accord avec Franz Knieps, responsable de l’association des caisses d’assurance maladie des entreprises en Allemagne et depuis de nombreuses années en contact étroit avec la chancelière allemande Angela Merkel, qui a déclaré mi-janvier que «si vous ne testiez plus , Corona disparaîtrait. « 

Fait intéressant, même le virus-tsar allemand hyper-orthodoxe et principal conseiller du gouvernement sur les verrouillages et autres mesures, Christian Drosten, s’est contredit sur la fiabilité des tests PCR. Dans une interview de 2014 concernant les tests PCR pour le soi-disant MERS-CoV en Arabie saoudite, il a déclaré:

La méthode [PCR] est si sensible qu’elle peut détecter une seule molécule héréditaire du virus. Par exemple, si un tel agent pathogène se trouve juste à traverser la membrane nasale d’une infirmière pendant une journée sans qu’elle tombe malade ou ne remarque rien, alors elle est soudainement un cas de MERS. Là où des décès étaient précédemment signalés, les cas désormais bénins et les personnes en parfaite santé sont soudainement inclus dans les statistiques de déclaration. Cela pourrait également expliquer l’explosion du nombre de cas en Arabie saoudite. De plus, les médias locaux ont porté l’affaire à des niveaux incroyables. »

Cela vous semble vaguement familier?

Et même Olfert Landt critique les résultats des tests PCR, affirmant que seulement la moitié environ des personnes «infectées par corona» sont contagieuses . Ceci est plus que remarquable car Landt n’est pas seulement l’un des co-auteurs de Drosten dans Corman et al. papier – le premier protocole de test PCR accepté par l’OMS, publié le 23 janvier 2020 dans Eurosurveillance – mais aussi le PDG de TIB Molbiol, la société qui produit les tests selon ce protocole .

Malheureusement, ce conflit d’intérêts n’est pas mentionné dans l’étude Corman / Drosten et al. article, comme 22 scientifiques – parmi eux l’un des auteurs de cet article, Stefano Scoglio – ont critiqué dans une récente analyse approfondie .

Au total, Scoglio et ses collègues ont trouvé «de graves conflits d’intérêts pour au moins quatre auteurs», dont Christian Drosten, ainsi que diverses failles scientifiques fondamentales. C’est pourquoi ils ont conclu que «le comité de rédaction d’Eurosurveillance n’a d’autre choix que de retirer la publication».

Le 11 janvier 2021, la rédaction d’Eurosurveillance a répondu à l’e-mail de Torsten Engelbrecht demandant un commentaire sur cette analyse:

Nous sommes au courant d’une telle demande [de rétractation du Corman / Drosten et al. paper] mais nous espérons que vous comprendrez que nous ne faisons actuellement aucun commentaire à ce sujet. Cependant, nous travaillons à une décision d’ici la fin janvier 2021.

Le 27 janvier, Engelbrecht s’est de nouveau adressé au journal pour lui demander: «C’est maintenant la fin du mois de janvier. Alors permettez-moi de vous demander à nouveau: quel est votre commentaire sur l’analyse mentionnée de votre Corman / Drosten et al. papier? Et allez-vous retirer le Corman et al. papier – ou qu’allez-vous faire? Deux jours plus tard, la rédaction d’Eurosurveillance a répondu comme suit:

Cela prend du temps car plusieurs parties sont impliquées. Nous communiquerons notre décision dans l’un des prochains numéros réguliers de la revue.

DES MILLIARDS ET DES MILLIARDS GASPILLÉS SUR DES TESTS QUI NE PEUVENT PAS SIGNIFIER MOINS

Compte tenu du manque de faits pour la détection du nouveau virus présumé et pour que les tests PCR SARS-CoV-2 aient un sens, il est d’autant plus scandaleux que les coûts des tests ne sont pas discutés publiquement , car ils sont énormes. Souvent, nous entendons des politiciens et des chefs qui disent que répondant à certains critères, les tests sont gratuits, mais c’est un mensonge pur et simple. Ce qu’ils veulent dire, c’est que vous ne payez pas sur place mais avec vos impôts .

Mais quel que soit le mode de paiement, en Suisse, par exemple, le coût d’un test PCR est compris entre 140 CHF et 200 CHF (117 £ à 167 £). Alors, faisons le calcul. Au moment de la rédaction de cet article, la minuscule Suisse, avec une population de 8,5 millions d’habitants, a effectué environ 3 730 000 tests PCR SARS-CoV-2, en plus d’environ 500 000 tests antigéniques, qui sont un peu moins chers .

Compte tenu d’un prix moyen de 170 CHF par test PCR, cela représente un montant stupéfiant de 634 millions de CHF, soit 521 millions de £. Et malgré l’absurdité de tester des personnes asymptomatiques, la semaine dernière, le 27 janvier, le Conseil fédéral suisse a de nouveau appelé les personnes à se faire dépister. Annonçant que, dès le lendemain, les Suisses devront également payer avec leurs impôts pour des tests de masse sur des personnes asymptomatiques. Le Conseil fédéral suisse estime que cela coûtera environ 1 milliard de francs suisses .

L’épidémiologiste Dr Tom Jefferson a déclaré dans une interview au Daily Mail :

La plupart des kits PCR coûtent toujours plus de 100 £ à obtenir par le secteur privé, par exemple, et le gouvernement [britannique] dit qu’il en livre désormais 500 000 par jour. Mais même ces chiffres sont éclipsés par les 100 milliards de livres sterling que le Premier ministre est prêt à dépenser pour un rêve «  lunaire  » de fournir à la population des tests [PCR et autres types – ndlr.] Plus ou moins à la demande – seulement 29 milliards de livres de moins que le budget annuel de l’ensemble du NHS.

En Allemagne, le prix varie considérablement, selon également si le test est payé en privé ou non, mais en moyenne, il est similaire à ceux en GB, et à ce jour, ils ont effectué environ 37,5 millions de tests PCR .

C’est-à-dire que des milliards et des milliards sont dépensés – ou carrément «brûlés» – sur des tests qui ne peuvent pas signifier moins et qui alimentent la «chasse au cerf» moléculaire et numérique du monde entier pour un virus qui n’a jamais été détecté.

Torsten Engelbrecht est un journaliste d’investigation de Hambourg, en Allemagne. La nouvelle édition considérablement élargie de son livre «Virus Mania» (co-écrit avec le Dr Claus Köhnlein MD, le Dr Samantha Bailey MD et le Dr Stefano Scolgio BSc PhD) sera disponible début février. En 2009, il a remporté le prix allemand des médias alternatifs . Il était membre du personnel du Financial Times Deutschland et a également écrit pour OffGuardian, The Ecologist, Rubikon, Süddeutsche Zeitung et bien d’autres. Son site Web est www.torstenengelbrecht.com .


Le Dr Stefano Scoglio, BSc PhD, est un expert en microbiologie et naturopathie et coordonne la recherche scientifique et clinique sur les extraits d’algues Klamath et sur les probiotiques à base de microalgues, en coopération avec le Centre national de recherche italien et diverses universités. Depuis 2004, il a publié de nombreux articles dans des revues scientifiques internationales. En 2018, Scoglio a été nominé pour le prix Nobel de médecine.

Konstantin Demeter est photographe indépendant et chercheur indépendant. Avec le journaliste Torsten Engelbrecht, il a publié des articles sur la crise du «COVID-19» dans le magazine en ligne Rubikon, ainsi que des contributions sur le système monétaire, la géopolitique et les médias dans des journaux suisses italiens.

REMARQUES:-

  • [1] E-mail du 4 septembre 2020 [RETOUR]
  • [2] Courriel du 5 octobre 2020 [RETOUR]
  • [3] Les images sont tirées d’une présentation du Dr Andrew Kaufman, Ohio, l’un des principaux partisans de la théorie selon laquelle les virus sont en fait des exosomes. [ARRIÈRE]
  • [4] Courriel du 3 décembre 2020 [RETOUR]

Image d’en-tête: Alfred Abel, Rudolf Klein-Rogge et Gertrude Welcker dans Dr.Mabuse, der Spieler (1922)

En compléments:

– une vidéo de l’interview (en anglais) du Professeur Stefano Scoglio
– un article de Réseau International intitulé « Une nouvelle souche de coronavirus ou tromperie colossale. Un mirage peut-il en cacher un autre? « 

Une nouvelle étude du Dr Steven Quay conclut que le Sars-CoV-2 provient d’un laboratoire

D’après un article de France Soir du 31/1/2021

Ce 29 janvier 2021, dans un article publié par le Dr Steven Quay, MD, PhD., le PDG d’Atossa Therapeutics, conclut «une analyse bayésienne conclut au-delà d’un doute raisonnable que le Sars-CoV-2 ne soit pas une zoonose naturelle, mais plutôt un dérivé de laboratoire. ». Rapporté par PrNewswire

L’article fait 193 pages et peut être téléchargé à partir de Zenodo, un dépôt général en libre accès géré par le CERN et une courte vidéo explicative est mise en ligne.

Le but de l’analyse était de déterminer l’origine du SARS-CoV-2, le virus responsable du C0VID-19. Commençant avec une probabilité de 98,2% qu’il s’agissait d’un saut zoonotique de la nature avec seulement 1,2% de probabilité qu’il s’agissait d’une évasion de laboratoire, vingt-six faits et preuves différents et indépendants ont été examinés systématiquement. La conclusion finale est qu’il y a une probabilité de 99,8% que le Sars-CoV-2 provienne d’un laboratoire et seulement une probabilité de 0,2% qu’il provienne de la nature.

«Comme beaucoup d’autres, je suis préoccupé par ce qui semble être des conflits d’intérêts importants entre les membres de l’équipe de l’OMS et les scientifiques et médecins en Chine et à quel point cela empêchera un examen impartial de l’origine du SARS-CoV-2», a déclaré Dr Quay.

«En ne prenant que des preuves scientifiques disponibles publiquement sur le SARS-CoV-2 et en utilisant des estimations très prudentes dans mon analyse, je conclus néanmoins qu’il ne fait aucun doute raisonnable que le SARS-CoV-2 s’est échappé d’un laboratoire. Les preuves supplémentaires de ce qui semble être des séquences génétiques de vaccins adénovirus dans des échantillons de cinq patients de décembre 2019 et séquencées par l’Institut de virologie de Wuhan nécessitent une explication. Vous verriez ce genre de données dans un essai de provocation vaccinale, par exemple. J’espère que l’équipe de l’OMS pourra obtenir des réponses à ces questions. »

Le Dr Steven Quay a publié plus de 360 ​​contributions à la médecine et a été cité plus de 10 000 fois, le plaçant dans le top 1% des scientifiques du monde entier. Il détient 87 brevets américains et a inventé sept produits pharmaceutiques approuvés par la FDA qui ont aidé plus de 80 millions de personnes. Il est l’auteur du livre à succès sur la survie à la pandémie, Restez en bonne santé : Le guide d’un médecin pour survivre le Coronavirus.

Pour aider à trouver la vérité et obtenir des commentaires sur les méthodologies utilisées et les conclusions tirées dans cet article, une copie de prépublication de ce document a été envoyée à vingt-six scientifiques dans le monde, y compris les chercheurs de l’OMS actuellement à Wuhan, Wuhan Institute of Virology scientifiques, ainsi que d’autres virologues de premier plan.

Rappelons qu’en mai 2020 le professeur Luc Montagnier, prix Nobel de médecine, avait fait une déclaration identique avant de se faire lyncher par les médias.

Le Pr Tritto publiait un livre « La chimère qui a changé le monde » début aout 2020 confirmant cette thèse.

Un regard approfondi sur la vérité qui se cache derrière les vakx1s C0VlD par le Dr Simone Gold

Conférence brillante de Dr Simone Gold de americasfrontlinedoctors.com sur la vérité qui se cache derrière les vakx1 C0VlD (en 3 vidéos de ±20 min).

Le Dr Simone Gold, MD, JD, est un médecin urgentiste certifiée. Elle a obtenu son diplôme de la faculté de médecine de Chicago avant de suivre des cours à la faculté de droit de l’université de Stanford pour obtenir son diplôme de docteur en droit (Juris Doctorate). Elle a effectué son internat en médecine d’urgence à l’hôpital universitaire de Stony Brook à New York. Le Dr Gold a travaillé à Washington D.C. pour le « Surgeon General »(12), ainsi que pour le président de la commission du travail et des ressources humaines. Elle travaille comme médecin urgentiste de front, qu’il y ait ou non une pandémie. Son travail clinique est au service de tous les Américains : des citadins, des quartiers et des Amérindiens. Son travail juridique se concentre sur les questions politiques liées au droit et à la médecine.

Partie 1 (22 min)

https://lbry.tv/@Miniver:4/firstone:0

Partie 2 (18 min)

https://lbry.tv/@Information:54/-VOSTFR–Un-regard-approfondi-sur-la-v%C3%A9rit%C3%A9-qui-se-cache-derri%C3%A8re-le-vaccin-COVID-19-Partie-2_3-(720p):0

Partie 3 (17 min)

https://lbry.tv/@Miniver:4/third:c

pétition à signer: stopmedicaldiscrimination/

L’imposture vakxinale de Pasteur

L’imposture vakxinale (Extrait du site la-philosophie.fr)
La France, pays de Descartes et de la rationalité scientifique est tombée dans une bien étrange assuétude : la dépendance aux vakx1s. Si la France est bien la patrie de Descartes elle est aussi, pour son plus grand malheur, celle de Louis Pasteur !

La démonstration d’un fait scientifique par la méthode expérimentale ne repose que sur des mesures de laboratoire, reproductibles, vérifiées par d’autres scientifique et indiscutables.

Premier mensonge ou péché par omission : Contrairement à ce que croit une majorité de Français, Louis Pasteur (1822-1895) n’était pas médecin, ni même biologiste, il n’était que “agrégé-préparateur de chimie” sans que l’on en sache plus sur cette dénomination, et … pas très bon dans sa spécialité. La seule chose qu’on ne peut pas lui enlever : c’était un travailleur acharné, il dormait moins de 4 heures par nuit. Dans les années 1850, Internet n’existait pas et Louis Pasteur était au courant de tout ce qui se passait dans le monde scientifique de l’époque. C’était un activiste, arriviste, il voulait la Légion d’Honneur et il l’a eue (en 1853) ! Louis Pasteur fut le seul Français, à ma connaissance, à avoir bénéficié de son vivant du titre de “bienfaiteur de l’humanité”. Mais, quand on creuse un peu, on se rend compte que la réalité est bien loin de la légende.

Tous les travaux que Pasteur s’attribua sans vergogne, furent en fait “copiés” sur d’autres scientifiques. La seule vraie découverte de Pasteur et dont personne ne parle jamais, c’est la serviette en papier jetable pour s’essuyer les mains. Pasteur était paranoïaque, il voyait des microbes partout, et il pensait, fort justement, qu’en s’essuyant deux fois les mains dans la même serviette on avait toujours les mains sales.

La vérité : Pasteur n’a jamais découvert aucun micro-organisme, à l’origine, il n’y croyait d’ailleurs pas, attribuant la maladie à “une faiblesse constitutionnelle” la découverte en incombe à un vrai biologiste : Antoine Béchamp (1816-1908) docteur en sciences, en médecine et en chimie et diplômé en pharmacie, dont en France, le nom est toujours interdit de cité (lire sur Internet le très intéressant article que lui consacre l’encyclopédie en ligne Wikipédia). Antoine Béchamp avait appelé ces structures microscopiques : microzymas, ( 3.1 Antoine Béchamp et la théorie du microzyma). Pasteur les a rebaptisés : microbes “empruntant” ce nom au chirurgien Français Sédillot (1808-1875).qui fut le premier à l’utiliser.

Béchamp ne courait pas après la gloire, Pasteur si ! Béchamp ne fut pas dupe des manœuvres de Pasteur, car il écrivit : “Je suis le précurseur de Pasteur, exactement comme le volé est le précurseur de la fortune du voleur heureux et insolent qui le nargue et le calomnie.”

Le théorème pasteurien : L’être humain, créature de Dieu est pure et sans souillure, la maladie ne peut donc être provoquée que par une “faiblesse constitutionnelle” puis, se ravisant, devant la démonstration évidente d’Antoine Béchamp sur l’origine de la maladie des vers à soie (sujet sur lequel ils travaillaient tous les deux), la maladie est provoquée par des “agents” extérieurs. En injectant cet agent dans le corps, on crée une réaction de défense qui protège de la maladie.

N’oublions pas qu’à cette époque (milieu du 19ème siècle) la médecine était d’essence religieuse, on croyait à la “force vitale” (impossibilité de passer du règne “minéral” au règne “organique” sans cette “force vitale” nécessairement d’origine divine) et “à la génération spontanée” le cadavre d’un animal pourrit car il génère des éléments destructeurs sortis de nulle part (on croyait que les asticots de mouche étaient générés par le cadavre) ! Béchamp n’était ni “vitaliste” ni ne croyait à la génération spontanée, ce qui n’était pas le cas de Pasteur, tout du moins à ses débuts ! Pasteur était opportuniste et savait s’adapter à “l’air du temps” (il n’y a que les imbéciles qui ne changent jamais d’avis !).

De ce théorème (jamais démontré) découle donc le corollaire (pas plus démontré) : pour lutter contre les maladies et les épidémies, il suffit donc de “vakxiner” (terme emprunté à Jenner) massivement les populations avec le ou les agents responsables de ces maladies.

A ce stade, on fait tout simplement l’impasse totale des connaissances que nous avons aujourd’hui sur le système immunitaire humain et la génétique en général. Ce raisonnement implique que tous les humains possèdent le même système immunitaire et que celui-ci répond d’une manière identique aux mêmes sollicitations extérieures. L’immunité de troupeau, prônée par Pasteur et ses disciples n’existe tout simplement pas, c’est une hérésie scientifique !

L’hérésie scientifique : Au 21ème siècle, nous raisonnons, dans ce domaine particulier, avec des théories élaborées au 19ème siècle, et que personne ne semble remettre en cause ? il s’agit tout simplement d’une aberration de l’esprit humain et de la négation de nos connaissances scientifiques actuelles !

Le mensonge :
Ce théorème induit un deuxième corollaire : chaque “micro-organisme pathogène” est responsable d’une maladie parfaitement identifiée.

Faux : en matière scientifique la causalité unique n’existe pas, tout événement observable est le produit d’un enchaînement de causes. La suppression d’une seule de ces causes rend l’événement impossible !

D’abord, qu’est-ce qu’une maladie ? à ce jour, je n’ai encore rencontré personne qui soit capable de répondre à cette question élémentaire. Les sommités médicales que j’ai pu interroger sur ce sujet, n’ont pu me fournir qu’un sourire gêné en guise de réponse. Nous ne savons pas ce qu’est une maladie.

Le mensonge :
Pasteur a prétendu avoir vu le virus de la rage avec son petit microscope optique. Pour observer le virus de la rage, il faut un microscope électronique car la taille du virus est inférieure au pouvoir discriminant du microscope optique.

 Le mensonge :
les vakxins ont permis de mettre un terme aux grandes épidémies qui dévastaient l’humanité ! La vérité :
Aux 13ème et 14ème siècle, l’Europe fut dévastée par plusieurs épidémies de peste qui tuèrent des centaines de milliers d’individus. Ces épidémies disparurent pour ne jamais revenir, qui a inventé le vakx1 contre la peste ? 
Le mensonge :
la variole a été éliminée de la surface de la Terre grâce au vakxin.
La vérité :
c’est l’OMS elle-même, pourtant entièrement à la solde des labos pharmaceutiques qui, en 1980, lança un appel à tous ses adhérents pour arrêter les vackxinations antivarioliques et détruire les souches virales encore détenues dans certains labos. Les dernières campagnes de vakxination s’étaient toutes soldées par une poussé épidémique quel que soit le pays où eut lieu cette campagne ! Le mensonge :
Les vakx1s sont inoffensifs et les accidents qu’on attribue aux vakx1s ne sont que de tristes coïncidences.

La vérité :
les vakx1s sont des médicaments au même titre que les autres molécules de la pharmacopée et, à ce titre, ils sont dangereux et toxiques. Les médicaments tuent en moyenne 20 000 personnes par an en France, et les vakx1s ne tueraient personne ? C’est un miracle, et dans les labos, les miracles, ça n’existe pas !

Se mettre dans la tête qu’on va “éradiquer” telle ou telle maladie, ou le virus responsable est une illusion dangereuse. Chaque fois que les humains vident une niche écologique d’un de ses occupants, la Nature ayant horreur du vide, la niche va être occupée par un nouvel habitant souvent pire que le précédent. Tout ce que nous risquons, c’est d’éradiquer l’espèce humaine de la surface de la planète, mais la Nature se passe très bien de nous !

Ce que contient réellement un vakx1 : une partie dite “atténuée” d’un virus ou bactérie que l’on croit responsable d’une maladie, des éléments de manipulations génétiques comme les ARN ou ADN double brin. Des traces protéiques du milieu de culture, car on ne sait pas filtrer totalement la fraction vakxinale. Ce qui veut dire que si les protéines de culture sont polluées pour une raison ou une autre, le vakx1 le sera aussi. Il contient également des adjuvants tels l’hydroxyde d’aluminium qui se révèle un redoutable toxique puisqu’il est capable de traverser la barrière hémato-encéphalique. Le cerveau est le seul organe humain qui soit stérile et qui doit le rester, y introduire un produit chimique amène des accidents graves. Pourquoi retrouve-t-on des traces d’aluminium dans les plaques amyloïdes de la maladie d’Alzheimer ? Les coupes qui servirent en 1906 à Alzheimer à décrire la maladie qui porte son nom existent toujours, elles ont été examinées de nouveau avec nos techniques modernes et il n’y a aucune trace d’aluminium dans ces coupes. L’aluminium trouvé dans les cerveaux (examen post-mortem) analysés est … celui des vakx1s !

On y trouve aussi des traces de formaldéhyde, cancérogène de 1ère classe, des sels de mercure (stabilisants) le mercure est un neurotoxique reconnu, personne ne peut le mettre en doute.

Le “vakxinalisme” est une manie française. Chaque petit Français doit recevoir entre 0 et 18 ans pas moins de 60 injections vakxinales.

Les trucages des labos : il y a en France des obligations vakxinales, les labos s’ingénient à mélanger dans la même ampoule les obligatoires avec les autres, il faut bien faire marcher le commerce ! Nous avions essayé de mettre au point une “dose” magistrale qui contenait 10 virus ! Ils se sont bouffés entre eux, on n’a pas pu dépasser 6, ce fut “l’Hexavac” une belle réussite commerciale et un calvaire pour les vakxinés. Mis sur le marché en 2003 il a été retiré, sur recommandation de l’Afssaps en 2005.

La théorie et le mythe pasteuriens ne souffrent en France aucune discussion ni aucune contestation. La vakxination de masse est devenue une religion, on y croit sans voir et sans preuve “Heureux celui qui croira sans avoir vu” et ce sont les opposants, majoritairement des scientifiques qui passent pour des illuminés, membres de sectes inavouées et inavouables.

J’avoue, j’appartiens à cette redoutable secte des chercheurs qui ne croient pas aux discours majoritaires. Claude Bernard, qui reste mon maître à penser en la matière, écrivait dans “Introduction à la médecine expérimentale” (1865) “Le scientifique est d’abord un douteur …” où est le doute aujourd’hui ?

Ce fut aussi Claude Bernard qui arbitra le match : Pasteur vs Béchamp et, à la fin de sa vie, il eut cette phrase remarquable : “ Béchamp a raison, le microbe n’est rien, c’est le terrain qui est tout, Pasteur est fou !” (phrase que l’on attribue aussi à Pasteur, donnant raison à Béchamp, ce qui est proprement impensable) Sur la fin de sa vie, Pasteur eut un AVC qui le laissa hémiplégique, il perdit complètement la raison et se lança dans des théories encore plus folles et plus fausses que celles de ses débuts !

L’organisme humain est une merveille d’équilibre, entre ses propres cellules et des cellules étrangères, virus et autres bactéries, c’est la rupture de cet équilibre qui provoque ce que l’on appelle “maladie” le système immunitaire n’est pas un jouet. Vakxiner un bien-portant et l’on en fait un malade chronique !

Le mensonge :
le tétanos, la rage, la poliomyélite ont été endigués par la vakxination !

La vérité :
ces trois maladies sont des maladies sans immunité, les toxi-infections ne passent pas par la voie sanguine.

Le mensonge :
la vakxiantion ROR a permis de supprimer les maladies infantiles !

La vérité :
ces maladies dites “infantiles” servent à la maturation du système immunitaire de l’enfant pour en faire un adulte en bonne santé. Avec le ROR on a créé des souches mutantes de la rougeole et des adultes qui l’avaient eu enfants, l’attrapent sous une forme “aggravée” au contact de leurs enfants vakxinés.

Le mensonge :
Nos enfants deviendront centenaires !

La vérité :
les centenaires d’aujourd’hui sont des personnes qui sont nées dans les années 1910, époque où il n’y avait pas de vakxinations obligatoires ! On en reparlera dans quelques années.

Toutes les études internationales arrivent à la même conclusion : les enfants à jour des vakxinations obligatoires sont globalement en plus mauvaise santé que ceux qui n’ont jamais été vakxinés.

Le mensonge :
il faut vakxiner les personnes fragiles pour les protéger.

La vérité :
toute personne atteinte d’un déficit immunitaire ou souffrant d’une pathologie auto-immune est une contre-indication majeure à toute forme de vakxination ! Pour qu’une vakxination soit réellement efficace, il faudrait faire un groupage HLA à chaque individu pour connaître l’état exact de ses défenses immunitaires. Trop cher ! Répondent les autorités dites “compétentes” et on vit avec les accidents vakxinaux qui ne sont officiellement que de la faute à pas de chance ou à des coïncidences malencontreuses.

L’aveuglement des autorités sanitaires françaises nous conduit à une catastrophe sanitaire majeure qui a déjà commencé à bas bruit. Tous ces cas d’autisme soudain, d’hyperactivité, de cancers infantiles ne seraient dus qu’à des problèmes environnementaux? L’air pollué ? La malbouffe ? Disons que ça se cumule et comme l’on ne connaît pas les synergies entre tous ces éléments, la prudence voudrait qu’on arrête les frais et que l’on ne sacrifie plus nos enfants et petits-enfants sur l’autel du profit industriel !

En conclusion : le principe de la vakxination de masse ne repose sur aucune base scientifique indiscutable et démontrée.

Marc JASPARD, Chimiste – Biochimiste 
05 10 2012

La page complète du site la-philosophie.fr)

Une idée fausse appelée virus?

Suite de la série sur l’existence réelle du virus …

D’après un article paru dans GlobalResearch, l’avis du virologue allemand Stefan Lanka, très controversé (ce qui est souvent le cas pour les personnalités indépendantes remettant en cause un paradigme bien installé et profitant largement à des pouvoirs en place).

Je soumets ci-dessous à votre intelligence, la version traduite en français avec l’outil Deepl.

L’idée fausse du virus est au cœur de l’opération Coronavirus, car sans le concept de la théorie des germes et sans l’histoire d’horreur du virus tueur, la plupart des gens n’achèteraient pas le récit officiel de la propagande COVID dirigé par NWO. Dans un article précédent sur la nature du virus, j’ai parlé des efforts héroïques du Dr Stefan Lanka, virologue allemand, qui a remporté en 2017 une affaire qui a fait date et s’est rendue jusqu’à la Cour suprême allemande. Lanka a prouvé devant la plus haute cour du pays que la rougeole n’était pas causée par un virus, et qu’il n’existait en fait pas de virus de la rougeole. Lanka est toujours occupé à travailler, et il a écrit cet article au début de l’année (traduit en anglais ici) intitulé « The Misconception called Virus » dans lequel il explique l’histoire de la façon dont la science dominante s’est horriblement trompée dans ses conclusions (en fait, ses hypothèses) pour diaboliser l’humble virus et lui attribuer à tort une pathogénicité alors qu’il n’y en a pas.

L’idée fausse du virus : L’histoire du virus tueur contre la carence et la toxicité

Le point principal de l’article de Lanka est le suivant : lorsque les scientifiques modernes travaillent avec des tissus malades, ils pensent que la présence d’un virus provoque la maladie, au lieu de réaliser que le tissu en question a été coupé et isolé de son hôte, puis aspergé d’antibiotiques, et que cette séparation et ce poison le rendent malade et le tuent, plutôt que n’importe quel virus. écrit Lanka :

« Toutes les affirmations sur les virus en tant qu’agents pathogènes sont fausses et sont basées sur des interprétations erronées facilement reconnaissables, compréhensibles et vérifiables … Tous les scientifiques qui pensent travailler avec des virus en laboratoire travaillent en fait avec des particules typiques de tissus ou de cellules spécifiques mourants qui ont été préparés d’une manière spéciale. Ils pensent que ces tissus et cellules meurent parce qu’ils ont été infectés par un virus. En réalité, les cellules et les tissus infectés meurent parce qu’ils ont été affamés et empoisonnés à la suite des expériences en laboratoire ».

 » … la mort des tissus et des cellules se produit exactement de la même manière lorsqu’aucun matériel génétique « infecté » n’est ajouté. Les virologistes n’ont apparemment pas remarqué ce fait. Selon … la logique scientifique et les règles de conduite scientifique, des expériences de contrôle auraient dû être effectuées. Afin de confirmer la méthode nouvellement découverte de « propagation du virus » … les scientifiques auraient dû effectuer des expériences supplémentaires, appelées expériences de contrôle négatif, dans lesquelles ils auraient ajouté des substances stériles … à la culture cellulaire ».

« Ces expériences de contrôle n’ont jamais été réalisées par la « science » officielle jusqu’à ce jour. Lors de l’essai sur le virus de la rougeole, j’ai demandé à un laboratoire indépendant de réaliser cette expérience de contrôle et le résultat a été que les tissus et les cellules meurent en raison des conditions de laboratoire exactement de la même manière que lorsqu’ils entrent en contact avec du matériel prétendument « infecté » ».

En d’autres termes, les cellules et les tissus étudiés meurent avec ou sans la présence d’un virus exactement de la même manière ; le virus ne peut donc pas être la cause de la morbidité et de la mortalité. Il est intéressant de noter que c’est exactement ce que de nombreux experts de la santé ont déclaré, à savoir qu’il n’y a que 2 causes de maladie : la carence et la toxicité. Par exemple, Charlotte Gerson (qui a repris la direction de la clinique Gerson de son brillant père Max) a dit ceci à propos de la maladie et du cancer. Le fait de retirer des cellules ou des tissus de l’organisme et de les couper ainsi de leur approvisionnement en énergie/nutriments entraîne rapidement une carence ; l’injection d’antibiotiques dans le mélange est toxique ; il n’y a donc pas de preuve solide qu’un virus provoque une maladie alors qu’il y a déjà une carence et une toxicité. C’est le point clé de l’idée fausse que l’on se fait du virus

Comment la fausse idée du virus a pris racine en 1858 et s’est enracinée en 1954

Lanka remonte à 1858 et à la « théorie cellulaire » de Rudolf Virchow, qui a proposé une théorie selon laquelle toute maladie et toute vie proviennent d’une seule cellule, qui est en quelque sorte détournée par un virus qui l’affaiblit et se propage. Lanka souligne deux problèmes à cet égard :

« La théorie de la cellule n’a vu le jour que parce que Rudolf Virchow a étouffé des découvertes cruciales sur les tissus. Les découvertes et les idées concernant la structure, la fonction et l’importance centrale des tissus dans la création de la vie, qui étaient déjà connues en 1858, réfutent complètement la théorie de la cellule et les thérapies génétiques, immunitaires et anticancéreuses qui en ont découlé par la suite.

« Les théories de l’infection n’ont été établies en tant que dogme global que par les politiques concrètes et l’eugénisme du Troisième Reich. Avant 1933, les scientifiques ont osé contredire cette théorie ; après 1933, ces scientifiques critiques ont été réduits au silence ».

Par « théories de l’infection », Lanka entend la théorie des germes, la théorie dominante de la médecine occidentale moderne. Lanka décrit ensuite comment un changement de paradigme dans la perception du virus s’est produit au cours des années 1952-1954 :

« Jusqu’en 1952, un virus était défini comme un poison pathogène sous la forme d’une protéine, qui en tant qu’enzyme causait des dommages d’une manière inconnue, qui pouvait provoquer une maladie et être transmissible. Après 1953, année où le prétendu ADN sous forme d’une prétendue hélice alpha a été annoncé publiquement, l’idée d’un virus est devenue un génotype malin enveloppé dans des protéines. Ainsi, un changement de paradigme a eu lieu entre 1952 et 1954 concernant l’image d’un virus ».

Il explique comment la théorie est devenue un dogme dans l’Eglise de la science traditionnelle (alias le scientisme) :

« Cette approche totalement non scientifique a vu le jour en juin 1954, lorsqu’un article spéculatif non scientifique et réfutable a été publié, selon lequel la mort de tissus dans une éprouvette était considérée comme … une preuve possible de la présence d’un virus. Six mois plus tard, le 10 décembre 1954, l’auteur principal de cet avis a reçu le prix Nobel de médecine pour une autre théorie tout aussi spéculative. La spéculation de juin 1954 a alors été élevée au rang de fait scientifique et est devenue un dogme qui n’a jamais été remis en cause à ce jour. Depuis juin 1954, la mort de tissus et de cellules dans une éprouvette est considérée comme la preuve de l’existence d’un virus ».

Revenons aux postulats de Koch : Pas d’isolement, pas de purification

Comme je l’ai expliqué dans COVID-19, terme générique pour désigner une fausse pandémie : Pas une seule maladie, pas une seule cause, les scientifiques traditionnels d’aujourd’hui sautent la deuxième étape importante des postulats de Koch : l’isolement et la purification du virus. Ce n’est pas quelque chose que l’on peut simplement ignorer ou oublier de faire, comme par exemple oublier accidentellement son parapluie un jour de pluie et se mouiller un peu. C’est la quintessence absolue pour déterminer s’il y a un nouveau virus et s’il provoque une maladie. C’est la condition sine qua non. Si vous ne pouvez pas l’isoler, vous n’avez rien à prouver, car la ramification bourgeonnante que vous pensez être un virus envahissant pourrait facilement être un exosome ou une particule produite par le corps lui-même.

C’est pourquoi toute la propagande COVID a commodément occulté le fait qu’il n’existe pas d’images du SRAS-CoV-2 au microscope électronique, puisque le microscope électronique est un outil extrêmement important dans la première étape des postulats de Koch, l’identification.

Lanka continue :

« … un virus n’a jamais été isolé selon la signification du mot isolement, et il n’a jamais été photographié et caractérisé biochimiquement comme une structure unique dans son ensemble. Les micrographies électroniques des prétendus virus montrent en réalité des particules cellulaires tout à fait normales provenant de tissus et de cellules mourantes, et la plupart des photos ne montrent qu’un modèle informatique (CGI – images générées par ordinateur) ».

Quel est donc le rapport avec le COVID ?

Pour en revenir à la plandémie actuelle, les mêmes hypothèses et le même manque de preuves sont en jeu en ce qui concerne le COVID :

« Les molécules individuelles sont extraites des particules de tissu et de cellules mortes, elles sont interprétées à tort comme faisant partie d’un virus et sont théoriquement rassemblées dans un modèle de virus … Le processus de recherche d’un consensus pour le « virus » de la rougeole, dans lequel les participants ont débattu afin de déterminer ce qui appartenait au virus et ce qui n’y appartenait pas, a duré des décennies. Avec le Coronavirus chinois 2019, apparemment nouveau (2019-nCoV, entre-temps renommé), ce processus de recherche de consensus ne dure que quelques clics de souris.

En quelques clics de souris également, un programme peut créer n’importe quel virus en rassemblant des molécules de courtes parties d’acides nucléiques provenant de tissus et de cellules morts avec une composition biochimique déterminée, les arrangeant ainsi comme on le souhaite en un génotype plus long qui est alors déclaré être le génome complet du nouveau virus … dans ce processus de construction théorique de « l’ADN viral », les séquences qui ne correspondent pas sont « lissées » et celles qui manquent sont ajoutées. Ainsi, on invente une séquence d’ADN qui n’existe pas dans la réalité et qui n’a jamais été découverte et scientifiquement démontrée dans son ensemble ».

Ainsi, les scientifiques chinois traditionnels qui travaillent selon la même théorie que les scientifiques occidentaux traditionnels ont inventé un nouveau modèle théorique pour le SRAS-CoV-2, et ont proclamé un nouveau coronavirus, mais tout cela sans les micrographies électroniques pour l’étayer.

Tout ce processus présente des parallèles extrêmement intéressants avec le thème de la contrefaçon spatiale, qu’elle soit propagée par la NASA ou les agences spatiales d’autres nations. Nous n’avons pas d’images vérifiables de virus ; nous n’avons pas d’images vérifiables (non composites) de la Terre, ou de nombreux autres corps spatiaux tels que des lunes, des planètes, etc. Au lieu de cela, on nous nourrit de CGI et on nous dit de ne pas remettre en cause l’autorité. S’agit-il de science ou de scientisme religieux ? Dans quelle mesure sommes-nous manipulés lorsque l’on nous refuse des photographies réelles et authentiques du monde qui nous entoure, tant au niveau micro que macro ? Je dirais dans une large mesure.

Lanka sur le danger des vaccins

Notre manque de compréhension des virus, des maladies, du système immunitaire, de la théorie du terrain et de bien d’autres choses encore est exploité par les grandes entreprises pharmaceutiques pour pousser à des interventions médicales dangereuses telles que les vaccins. Voici ce que le Lanka a à dire sur le danger et l’inefficacité des vaccins :

« [Une] concoction composée de tissus et de cellules mourants de singes, de fœtus de bovins et d’antibiotiques toxiques … est utilisée comme un vaccin « vivant », parce qu’elle est censée être composée de virus dits « atténués » … [ce] mélange toxique plein de protéines étrangères, d’acides nucléiques étrangers (ADN/ARN), d’antibiotiques cytotoxiques, de microbes et de spores de tous types est qualifié de « vaccin vivant ». Il est implanté chez les enfants par la vaccination principalement dans les muscles, en quantité telle que s’il était injecté dans les veines, il entraînerait immédiatement une mort certaine… Les faits vérifiables démontrent le danger et la négligence de ces scientifiques et politiciens, qui prétendent que les vaccins sont sûrs, n’ont que peu ou pas d’effets secondaires, et protégeraient d’une maladie. Aucune de ces affirmations n’est vraie et scientifique, au contraire : après une analyse scientifique précise, on constate que les vaccins sont inutiles et la littérature respective admet l’absence de toute preuve en leur faveur ».

Réflexions finales

Le virus est une idée fausse qui nous habite depuis longtemps. Aussi insensée que soit la soumission actuelle, basée sur la peur, le port de masques et la distanciation sociale, il y a des gens qui utilisent l’opération Coronavirus comme une chance de se réveiller. Alors que certains vont plus loin dans l’inconscience et se tournent vers de nouveaux produits de protection (« améliorez votre masque pour notre bouclier de protection à filtration d’air motorisé (N95) en instance de brevet »), d’autres ont vu le coup de maître du coronavirus pour ce qu’il est vraiment : une chance de déployer toutes sortes d’architectures de contrôle pendant que les gens somnambulant dans la peur. Il est toujours bon de remettre en question les hypothèses de base de toute déclaration gouvernementale, car presque toujours, cela peut ouvrir un portail qui mène à la vérité.

Makia Freeman.

Traduit avec http://www.DeepL.com/Translator (version gratuite)

Cet article a été publié à l’origine sur The Freedom Articles.

Makia Freeman est l’éditrice du site de médias alternatifs / d’informations indépendantes The Freedom Articles et chercheuse principale à ToolsForFreedom.com. Makia est sur Steemit.

Sources:

https://thefreedomarticles.com/deep-down-virus-rabbit-hole-question-everything/

https://davidicke.com/wp-content/uploads/2020/07/Paper-Virus-Lanka-002.pdf

https://thefreedomarticles.com/covid-19-umbrella-term-fake-pandemic-not-1-disease-cause/

https://thefreedomarticles.com/toxic-vaccine-adjuvants-the-top-10/

Pour compléter votre information, d’autres interviews ou exposés de Stefan Lanke:

http://www.sidasante.com/journal/stefzeng.htm

https://abruptearthchanges.com/2017/11/17/dr-stefan-lanka-the-history-of-the-infection-theory/ (le début de la transcription en français peut vous être fournie sur simple demande)

Ou encore ceci qui peut faire réfléchir:

Pour essayer de comprendre si ce virus a vraiment été identifié et isolé et s’il est la cause des symptômes observés.

Conversation très didactique entre le Dr Cowan (physicien, médecin holistique) et le reporter Jon Rappoport (vice-president de la maison d’édition Truth Seeker Company, Inc. et auteur lui-même) sur la non-isolation d’un virus Sars-Cov2.

Dr. Cowan: « Pour ceux d’entre vous qui ont suivi mes travaux concernant le COVID-19, vous savez que tout le fondement de l’histoire du virus repose sur le fait que le nouveau «virus corona» a été correctement isolé et tout son génome caractérisé. Beaucoup d’entre vous m’ont envoyé des articles qui ont été publiés dans de prestigieuses revues à comité de lecture qui prétendent avoir isolé et caractérisé ce nouveau virus. Ils sont tous incorrects.

En fait, l’article original de Corman-Drosten et sur lequel repose cet édifice de causalité virale déclare qu’ils ont utilisé un génome «in silico» d’un virus «in silico». «In silico» signifie «théorique» en latin. En anglais courant, les synonymes de théorique sont «imaginaire» ou «imaginaire».

Dans sa monographie de juillet 2020, le CDC déclare qu ‘«aucun isolé quantifié du nCov 2019 n’est disponible». Encore une fois, en anglais simple, cela signifie qu’ils n’ont aucun exemple de virus isolé en leur possession. Dans les demandes d’accès à l’information, le ministère canadien de la Santé, le ministère australien de la Santé et les gouvernements de nombreux pays du Commonwealth admettent qu’ils ne possèdent aucune étude démontrant l’isolement de ce prétendu virus.

Dans cette interview, et je l’espère pour la dernière fois, Jon Rappaport et moi décrivons dans un langage courant et en détail précis les étapes nécessaires pour bien isoler et caractériser un virus. Nous l’avons fait pour permettre à nos lecteurs et auditeurs de savoir par eux-mêmes comment lire et identifier la science frauduleuse. Parmi les nombreux défis auxquels nous sommes confrontés, l’un est l’analphabétisme scientifique rampant. Dans certains âges, cela n’a peut-être pas été pertinent, mais si nous voulons vivre à une époque où la «science» est la nouvelle religion et ses principes contrôlent nos vies, nous ferions mieux de comprendre ce que disent ses «prêtres» incontestés.

Je peux vous dire que plus je regarde ce qui passe pour la «science», plus je vois à quel point elle est pourrie. Si nous voulons avoir une nouvelle «religion», ayons une religion de vérité, de liberté, de justice et d’émerveillement et de crainte face aux phénomènes de la vie. Célébrons ce que signifie être un être humain doté d’un esprit libre dans une relation amoureuse avec le mystère qu’est notre monde. »

Vidéo en anglais (activez les sous-titres en anglais cela aide).

Une autre entrevue du Dr Cowan cette fois avec le Dr Andy Kaufman, très intéressante dans sa seconde partie pour envisager un autre paradigme et une autre compréhension du fonctionnement humain et de la maladie sans intervention d’élément externe pathologique (malheureusement toujours en anglais).

MISE A JOUR AU 29/12/2020: importante information pour conforter cette analyse:

Les services de santé d’Irlande qui avaient été sollicités pour répondre précisément à la question de savoir si le virus Sars-Cov2 avait été isolé, viennent de reconnaître qu’ils ne disposent d’aucun élément montrant que le virus avait été isolé !
Cela confirme un avis du CDC américain qui disait la même chose (voir plus haut)
S’en suivent maintenant beaucoup d’autres questions sur les souches variantes, les mesures de confinement, les obligations de port de masques, les vaccins, …

https://rumble.com/vc5pt8-today-they-were-forced-to-admit-that-covid-19-does-not-exist.html

La vakxination antigrippale depuis le 13 octobre 2020 est-elle responsable de la surmortalité observée en France entre le 15 et le 30 novembre 2020 et dans le reste de l’Europe ?

 Publié dans France Soir le 17/12/2020 à 10:04

Auteur(s): Un citoyen éclairé pour FranceSoir

La vakxination antigrippale depuis le 13 octobre 2020 est-elle responsable de la surmortalité observée en France entre le 15 et le 30 novembre 2020 et dans le reste de l’Europe ?

Résumé :

L’objectif de cette étude est de comprendre pourquoi nous observons une sensible surmortalité imputée au SARS-CoV-2 depuis le 20 octobre alors que l’existence d’une deuxième épidémie d’un même virus respiratoire ne présente aucun antécédent depuis l’ère moderne. Si nous connaissons les infections saisonnières dues à des mutations virales1, le cas d’une deuxième épidémie de SARS-CoV-2 paraît étrange, et cela d’autant plus qu’au premier octobre le taux de reproduction « R0 » était de 1, ne permettant plus une envolée épidémique. En revanche, un facteur coïncide avec l’augmentation nette des hospitalisations et des décès imputés au SARS-CoV-2 depuis le 20 octobre en France. Il s’agit du début de la campagne de vakxination antigrippale démarrée le 13 octobre, pour laquelle 5,3 millions de doses furent vendues en 8 jours, provoquant une rupture de stock sans précédent historique.

Notre réflexion, sur la base de la littérature scientifique et immunologique et d’études récentes concernant l’interaction négative entre vaccin antigrippal et SARS-CoV-2, nous amène à interpeller citoyens et autorités publiques sur le risque d’une potentialisation des effets du SARS-CoV-2 en cas de vakxination antigrippale. De nombreux signaux doivent nous inciter à prendre des précautions.

Les  maladies  automno-hivernales  :  rhinopharyngite,  otite,  bronchiolite,  infection  pulmonaire,  grippe,  gastro-entérite…

Lire la suite de l’article sur le site de France Soir

Conclusion de l’article :

L’objectif de cet article à vocation scientifique est d’interpeller les citoyens et les autorités publiques sur une très probable interaction négative entre vakxination antigrippale, mesures sanitaires excessives et risque de déclarer voire de décéder d’une infection par le SARS-CoV-2. Devant la mise en place de principes de précaution sanitaires qui apparaissent disproportionnés tels que le port du masque en population générale et en extérieur, mesure dont aucune étude n’a pu démontrer l’utilité43, ou encore le confinement, comment ne pas appliquer ce principe de précaution concernant le risque d’interaction négative entre la vakxination de masse antigrippale et le Covid-19 ? Ce deux poids, deux mesures n’est justifié par aucune raison solide. Nous osons dire que la campagne de vakxination massive contre la grippe cette année aura plutôt servi les intérêts opportunistes de Sanofi et de tous les industriels de la vakxination en dépit du bon sens et de la santé des citoyens.

Les citoyens doivent être informés de ces études et observations avant de procéder à une vakxination antigrippale , ou de tout autre vakx1, dont les effets secondaires sont systématiquement minorés par les autorités.

P.S de l’auteur :

Cet article a été rédigé par un citoyen de formation scientifique, libre et éclairé sur le sujet. L’auteur n’a aucun conflit d’intérêts puisqu’il ne travaille pas avec l’industrie pharmaceutique. D’autre part, l’auteur estime ne pas souffrir de conflit cognitif et égotique quant à la compréhension et l’analyse du sujet. Le conflit d’ordre cognitif semble être un frein majeur pour s’exprimer sur le sujet avec justesse et objectivité. En effet, il est très difficile pour un médecin ou un personne qui travaille dans le domaine de la santé, de remettre en question les connaissances qu’il a durement acquises au cours d’un cursus scolaire et universitaire, qui l’ont conforté dans son statut social. Ce phénomène est naturel, et rend les prises de positions bien plus délicate que les conflit d’intérêt, en effet la plupart des personnes qui travaillent avec l’industrie pharmaceutique sont sincères et s’appuient sur un corpus de connaissance qu’elles ne peuvent remettre en cause facilement.

La réflexion est appuyée par des faits, des publications scientifiques et de nombreux ouvrages écrits par des professionnels qui ont étudié l’immunologie et la vakxination en toute objectivité et sans conflits d’intérêts. Michel de Lorgeril, Michel Georget, pour ne citer qu’eux.

Plusieurs spécialistes se sont déjà interrogés sur la question soulever ici.

Le Dr. Michel de Lorgeril, sur son blog, dans deux articles, le 30 octobre et le 12 novembre, Le Dr. Louis Fouché au micro d’Exuvie TV le 26 novembre, Le microbiologiste Claude Escarguel au micro de FranceSoir le 28 novembre

Le virus existe-t-il ? La question mérite d’être posée.

Avez-vous entendu parler de la théorie émergente sur la nature des virus : les exosomes ?
Avez-vous entendu aussi parler des études d’Antoine Béchamp (concurrent de Pasteur) sur le microzymas ?
Êtes-vous absolument certain que le COVID-19 est contagieux ?
Quel est votre niveau de confiance dans les résultats du test ?

Ci-dessous un petit résumé (executive summary) de l’article téléchargeable (en anglais) de David Crowe (décédé en 2020) et ici le lien vers le site où il préparait un livre à ce sujet).

Et avant cela une petite vidéo sur les exosomes (sous-titres français).

https://odysee.com/@Eveilinfo:b/virus-vs-exosomes-test-pcr:a

Résumé de l’article traduit en français

Le monde souffre d’une énorme illusion basée sur la croyance qu’un test de RNA est un test pour un nouveau virus mortel, un virus qui a émergé de chauves-souris sauvages ou d’autres animaux en Chine, appuyés par l’hypothèse occidentale selon laquelle les Chinois mangera tout ce qui bouge.
Si le virus existe, il devrait être possible de purifier les particules virales. De ces particules l’ARN peut être extrait et doit correspondre à l’ARN utilisé dans ce test. Dans ce qui est fait, il est possible que l’ARN provienne d’une autre source, qui pourrait être les cellules du patient, bactéries, champignons, etc.
Il peut y avoir une association avec une niveaux de cet ARN et de la maladie, mais ce n’est pas la preuve que l’ARN provient d’un virus.
Sans purification et caractérisation des particules virales, il ne peut être accepté qu’un test d’ARN soit la preuve qu’un virus est présent. Les définitions des maladies importantes sont étonnamment vagues, peut-être embarrassantes. Quelques symptômes, peut-être un contact avec un patient précédent, et un test de une précision inconnue, c’est tout ce dont vous avez souvent besoin. Alors que la définition du SRAS, provenant d’une ancienne panique du coronavirus, est auto-limitante, la définition de la maladie COVID-19 est ouverte, permettant à l’épidémie imaginaire de se développer.

Mettant de côté l’existence du virus, si le test COVID-19 a un problème avec les faux positifs (comme le font tous les tests biologiques) alors tester une population non infectée ne produira que des tests faussement positifs, et la définition de la maladie permettra à l’épidémie de durer indéfiniment.
Cette nouvelle maladie étrange, officiellement nommée COVID-19, n’a aucun de symptômes propres . Fièvre et toux, précédemment attribuées à d’innombrables virus et bactéries, ainsi que les contaminants environnementaux, sont les plus courants, ainsi que les images pulmonaires anormales, malgré celles qui se trouvent chez des personnes en bonne santé.

Pourtant, malgré le fait que seule une minorité de personnes testées sera positive (souvent moins de 5%), on suppose que cette maladie est facilement reconnaissable. Si c’était vraiment le cas, la majorité des gens sélectionnés pour les tests par les médecins devraient être positifs. Le test COVID-19 est basé sur la PCR, une technique de fabrication d’ADN. Lorsqu’il est utilisé pour tester il ne produit pas un résultat positif / négatif, mais simplement le nombre de cycles nécessaire pour détecter suffisamment de matériau pour passer le seuil arbitraire entre le positif et négatif. Si positif signifie infecté et négatif signifie non infecté, alors il y a des cas de personnes qui passent d’infectées à non infectées et de nouveau à infectées dans les quelques jours suivant.
Beaucoup de gens disent qu’il vaut mieux prévenir que guérir. Mieux vaut que certaines personnes soient mis en quarantaine qui ne sont pas infectés que risquent une pandémie. Mais une fois que les gens sont testés positifs, ils sont susceptibles d’être traités avec des traitements similaires au SRAS. Les médecins face à ce qu’ils croient être un traitement antivirus mortel pour l’avenir, pour les symptômes anticipés, pas pour ce qu’ils voient aujourd’hui. Cela conduit à l’utilisation d’une oxygénation invasive, à forte dose corticostéroïdes, médicaments antiviraux et plus encore. Dans ce cas, certaines populations de diagnostiqués (par exemple en Chine) sont plus âgés et plus malades que la population générale et moins capable de résister à un traitement agressif. Après que la panique du SRAS se soit calmée les médecins ont examiné les preuves et ont montré que ces traitements étaient souvent inefficaces, et tous ont eu des effets secondaires graves, tels qu’un déficit neurologique persistant, arthroplasties, cicatrices, douleurs et maladies du foie. Ainsi qu’une mortalité plus élevée.

L’étude complète en anglais et en PDF

L’étude téléchargeable sur le web

La chaîne d’Angelo Pergola consacrée aux microzymas d’Antoine Béchamp

S’il fallait encore d’autres preuves …

https://odysee.com/@MEDIAPORT:d/5_covid_bombshell_studies:a

Dans ces extraits de l’interview exclusive réalisée le 08/12/2020, le docteur Christian Vélot nous rappelle que le Covid-19 est loin d’être le virus extrêmement dangereux présenté par les médias de masse. Rappelons au passage que que Christian Vélot est aujourd’hui président du conseil scientifique du CRIIGEN (Comité de Recherche et d’Information Indépendantes sur le génie Génétique) fondé le 1er juin 1999.

https://odysee.com/@la-chaine-qui-pique:f/le-covid-n-est-pas-un-virus-tueur-d:1https://odysee.com/@la-chaine-qui-pique:f/le-covid-n-est-pas-un-virus-tueur-d:1


Interview intégrale dans laquelle le docteur Christian Vélot commence par expliquer le principe des différents vaccins, des plus anciens aux plus récents. Puis il pointe les dangers potentiels de ces vaccins « nouvelle génération »: C0VID Les technologies


Site Web du CRIIGEN: https://criigen.org/


Note d’expertise grand public sur les vaccins OGM: https://criigen.org/wp-content/uploads/2020/12/2020-09_Note-dExpertise-Vaccins-GM_C.Ve%CC%81lot-06.pdf

Pour cet éminent professeur allemand, ce virus n’est pas le virus dévastateur qu’on voudrait qu’il soit.

Prof. Dr. Sucharit Bhakdi qui a été le directeur de l’Institut de Microbiologie médicale et d’Hygiène à l’Université Johannes Gutenberg de Mayence pendant 22 ans. Il est l’un des infectiologues les plus respectés au monde, et l’un des chercheurs les plus cités en Allemagne. 
Pour lui toute cette agitation autour du covid n’a aucun fondement scientifique, le port du masque dans les lieux publics et le confinement sont des crimes et la vaccination est dangereuse et inutile.

https://lbry.tv/@JeanneTraduction:a/SucharitBhakdiInterview:f

Louis Fouché: covid, vakx1 et conséquences

A ne pas manquer !
Comme toujours interventions très brillantes et très nourrissantes (séparée en 6 vidéos) du Dr Louis Fouché sur les libertés, l’information et les communications sur la pandémie, le virus, les vaccins, … Toujours très documenté et pertinent.
Je conseille particulièrement le n° 4.

Le Dr Pascal Sacré livre son analyse en toute liberté.

Le Dr Pascal Sacré, licencié pour s’être exprimé sur la non fiabilité des tests PCR notamment, livre toutes ses opinions lors d’une interview pour Kairos Presse. Il s’y exprime sur la gestion générale de la médecine, les tests, la fausse épidémie du Covid, les vaks1, la corruption de la médecine et des gouvernants, ….

Suite à cet interview, le Docteur Sacré a lancé un appel à la désobéissance civile dans la vidéo Facebook suivante:

https://fb.watch/23Qab48cZL/

COVID19 – Preuve d’une fraude mondiale !

Lien vers l’article original du site OffGuardian.org avec tous les liens

Iain Davis

Le COVID 19 et les réponses gouvernementales ultérieures semblent faire partie d’un complot international en vue de commettre une fraude. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID 19.

Parfois, vous devez suivre votre instinct. Je ne suis pas un expert en génétique et, comme toujours, je dois être corrigé. Cependant, mon attention a été attirée sur certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur  conseil consultatif, composé  de médecins et de scientifiques éminemment qualifiés, confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction en anglais (voir le précédent article de eveilinfo.org avec la traduction en français )  de leur rapport et je  peux corroborer l’exactitude de leurs affirmations concernant les séquences nucléotidiques répertoriées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire la même chose.

D-Salud-Discovery indique qu’il n’y a pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du COVID 19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de COVID 19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de celui-ci.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve d’une pandémie, simplement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, autre que les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette  «classe de parasites»  a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’enquêtes et de poursuites devant un tribunal.

IDENTIFICATION DE QUOI EXACTEMENT?

L’Organisation mondiale de la santé (OMS) a  classé le COVID-19  (COronaVIrus Disease 2019). Ils ont déclaré une pandémie mondiale de COVID 19 le 11 mars 2019.

Les directives de l’OMS sur les  analyses de laboratoire  stipulent:

L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau bêtacoronavirus, (dans la même famille que le SRAS-CoV et le MERS-CoV) via le séquençage de nouvelle génération (NGS) à partir du virus de culture ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus SRAS-CoV-2  provoque la maladie COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de situation 1 sur le nouveau coronavirus 2019-nCov de l’OMS  , ils déclarent:

Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 …… Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays l’utilisent dans le développement de kits de diagnostic spécifiques.

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour étude), puis des séquences génétiques ont été  identifiées à  partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été développés et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et des chercheurs chinois, ces tests permettront de trouver le virus responsable du COVID 19.

Pourtant, l’OMS déclare également:

Travaillant directement à partir des informations de séquence, l’équipe a développé une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des  «informations de séquence»  car il n’y avait pas d’échantillon isolé et purifié du virus dit SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines hérissée contenant l’ARN viral).

Cependant, ces structures protéiques ne sont  pas uniques . Ils ressemblent à d’autres vésicules rondes, telles que les vésicules endocytaires et les exosomes.

Les virologues affirment qu’il n’est pas possible d ‘  «isoler»  un virus car ils ne se répliquent qu’à l’intérieur des cellules hôtes. Ils ajoutent que  les postulats de Koch  ne s’appliquent pas parce qu’ils concernent des bactéries (qui sont des organismes vivants). Au lieu de cela, les virologues observent les effets cytopathogènes (CPE) du virus, provoquant la mutation et la dégradation des cellules, dans les cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé pour  la première fois le génome complet du SRAS-CoV-2, ils ont observé le CPE dans les cellules Vero E6 et Huh7. Vero E6 est une lignée cellulaire de singe immortalisée et Huh7 sont des cellules cancéreuses immortalisées (tumorigènes). Cela signifie qu’ils ont été maintenus in vitro (dans des cultures de boîtes de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 est l’idée qu’il s’agit d’un virus zoonotique, capable de combler le fossé des espèces entre les animaux et les humains. Lorsque des  scientifiques du CDC américain ont  «infecté»  diverses cellules avec le nouveau virus, ils ont noté ce qui suit:

Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires de primates et humaines communes, y compris les cellules d’adénocarcinome humain (A549) [cellules pulmonaires], les cellules hépatiques humaines (HUH7.0) et les cellules rénales embryonnaires humaines ( HEK-293T), en plus de Vero E6 et Vero CCL81 [cellules de singe]… Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero [cellules de singe]… Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et Les cellules A549 [cellules du tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2. »

Le CDC n’a observé aucun CPE dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, suggérant qu’une infection d’un humain à l’autre serait impossible.

Notant ce problème, une équipe de scientifiques polonais a introduit ce «virus» séquencé   dans  les cellules de l’épithélium humain (voies respiratoires) . Ils ont observé les effets sur ces cultures d’AOH pendant 5 jours. Ils ont noté une réplication beaucoup plus grande que les scientifiques du CDC, mais ont finalement déclaré:

«Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’AOH.»

Cela signifie qu’ils n’ont vu aucune preuve des virions supposés rompant la membrane de la paroi cellulaire. Encore une fois, suggérant que ce soi-disant virus n’est pas infectieux chez l’homme.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer des maladies. Cela peut même ne pas exister physiquement. N’est-ce rien d’autre qu’un concept basé sur   des séquences génétiques prédictives ?

VOYAGE DE DÉCOUVERTE

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2  (MN908947.1). Cela a été mis à jour plusieurs fois. Cependant, MN908947.1 était la première séquence génétique décrivant l’ agent étiologique présumé du COVID 19   (SARS-CoV-2).

Toutes les déclarations, tests, traitements, statistiques, développement de vaccins et politiques qui en résultent sont basés sur cette séquence. Si les tests pour ce  nouveau  virus n’identifient rien de capable de provoquer des maladies chez les êtres humains, tout le récit du COVID 19 n’est rien d’autre qu’une mascarade.

Les  chercheurs de WUHAN ont déclaré  qu’ils avaient effectivement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques, découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé un  assemblage de novo  et une PCR ciblée et ont trouvé 29 891 paires de bases partageant une correspondance de séquence de 79,6% avec le SARS-CoV.

Ils ont dû utiliser l’  assemblage de novo  parce qu’ils n’avaient aucune  connaissance a  priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle des chercheurs chinois ont  isolé  le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome du coronavirus du SRAS publié (SARS-CoV). Malheureusement, la précision du génome original du SRAS-CoV n’est pas non plus claire.

En 2003, une équipe de  chercheurs de Hong Kong a  étudié 50 patients atteints du syndrome respiratoire aigu sévère (SRAS). Ils ont prélevé des échantillons de 2 de ces patients et ont développé une culture dans des cellules hépatiques de singe foetal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques  «d’origine inconnue».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il appartenait à la famille des Coronaviridae. Considérant que ces séquences suggéraient un virus SARS-CoV nouvellement découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré:

Les amorces de détection du nouveau virus ont été conçues pour la détection par RT-PCR de ce génome de coronavirus humain associé à la pneumonie dans des échantillons cliniques. Sur les 44 échantillons de nasopharynx disponibles auprès des 50 patients atteints du SRAS, 22 présentaient des preuves d’ARN de coronavirus humain associé à la pneumonie.

La moitié des patients testés, qui présentaient tous les mêmes symptômes, ont été testés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce  nouveau  virus SRAS-CoV. La question n’a pas été posée.

Ce virus supposé n’avait qu’une correspondance de séquence de 57% avec le coronavirus prétendument connu. Les 43% restants étaient simplement  «là».  Les données séquencées ont été produites et enregistrées en tant que nouveau génome sous le numéro d’ accès GenBank  AY274119 .

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement renommée SARS-CoV-2). Personne, à aucun stade de ce processus, n’avait produit d’échantillon isolé et purifié de quelque virus que ce soit. Tout ce qu’ils avaient était des correspondances de séquence de pourcentage avec d’autres correspondances de séquence de pourcentage.

N’ISOLER RIEN

Les scientifiques sont très ennuyés car ils n’arrêtent pas de dire que le virus a été isolé mais personne ne les croit. C’est parce que, pour l’instant, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images de virions du SRAS-C0V-2 de confirmer qu’il s’agissait d’images d’un virus isolé et purifié. Aucun d’eux ne le pouvait .

En Australie, des scientifiques du  Doherty Institute ont annoncé avoir  isolé  le virus SARS-CoV-2 . Lorsqu’on leur a demandé de clarifier les choses, les scientifiques ont déclaré:

«Nous avons des séquences courtes (ARN) du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic»

Cela explique pourquoi le  gouvernement australien  déclare:

La fiabilité des tests COVID-19 est incertaine en raison de la base de preuves limitée… Il existe des preuves limitées disponibles pour évaluer l’exactitude et l’utilité clinique des tests COVID-19 disponibles.

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a  écrit une lettre  au Premier ministre britannique Boris Johnson dans laquelle ils lui ont demandé de:

Produire des preuves scientifiques examinées par des pairs de manière indépendante prouvant que le virus Covid-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a  adressé une demande d’accès à l’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. À quoi  ils ont répondu :

PHE peut confirmer qu’il ne contient pas d’informations de la manière suggérée par votre demande. « 

La chercheuse canadienne Christine Massey a fait une demande similaire d’accès à l’information, demandant la même chose au gouvernement canadien. À quoi le  gouvernement canadien a répondu :

Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu localiser aucun document répondant à votre demande. »

Aux États-Unis, le panneau de diagnostic RT-PCR du Center for Disease Control (CDC)   indique:

… Aucun isolat viral quantifié du 2019-nCoV n’est actuellement disponible …… .. La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent causal des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur de tout patient déclaré atteint de la maladie du COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou provoque le COVID 19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Voir aussi: Dr. Tom Cowan w/ Jon Rappoport: SARS-CoV-2 Has Never Been Isolated, Is Only an Imaginary or Theoretical Virus, and, Therefore, No Test Can Detect It

TESTER POUR RIEN

L’OMS, et chaque gouvernement, groupe de réflexion, comité directeur des politiques, conseiller scientifique du gouvernement, institutions supranationales et autres qui promeuvent le récit officiel du COVID 19, affirment que le SRAS-CoV-2 cause le COVID 19.

Bien que personne n’ait jamais produit un échantillon de ce supposé virus, le génome présumé du SRAS-CoV-2  a été publié . C’est dans le domaine public.

On dit que les séquences génétiques clés  du génome du SRAS-CoV-2 ont des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour  identifier  la présence du  «virus» . 

  • Ceux-ci incluent:
    • Gène ARN-polymérase (Rd-Rp) – Cela permet à l’ARN du SARS-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales atteintes de COVID 19.
    • Gène S (Orf2) – cette glycoprotéine forme le pic sur la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 sur les cellules, permettant à l’ARN à l’intérieur de l’enveloppe de la protéine du virion (capside) de passer dans la  cellule maintenant  infectée .
    • Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage viral
    • Gène N (Orf9a) – le gène de la nucléocapside qui lie l’ARN dans la formation de la capside

L’OMS tient un  registre accessible au public  des amorces et sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences nucléotidiques spécifiques qui se lient (s’hybrident) aux brins antisens et sens de l’ADNc synthétisé (appelées respectivement amorces sens et inverse).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences nucléotidiques appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Lors de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, la sonde se désintègre en libérant un fluorescent ou un colorant qui peut ensuite être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

L’ outil de recherche d’alignement local de base  (BLAST) est un autre élément accessible au public  . Cela permet à quiconque de comparer les séquences nucléotidiques publiées avec toutes celles stockées par la base de données génétique des National Institutes of Health (NIH) des États-Unis appelée GenBank. Par conséquent, nous pouvons BLASTER les amorces, sondes et séquences de gènes cibles du SRAS-CoV-2 revendiquées.

Les protocoles d’amorces et de sondes sens et inverses de l’OMS pour le génome viral présumé du SRAS-CoV-2 sont basés sur les profils de gènes RdRp, Orf1, N et E. N’importe qui peut les exécuter via BLAST pour voir ce que nous trouvons.

La séquence nucléotidique vitale RdRP, utilisée comme amorce sens est – ATGAGCTTAGTCCTGTTG. Si nous exécutons un nucléotide BLAST, celui-ci est enregistré comme un isolat  complet de SARS-CoV-2  avec une identité de séquence à 100%. De même, la séquence d’amorce du gène E inverse – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui  identifie également  SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences nucléotidiques des génomes microbiens et humains. Si nous recherchons la séquence RdRp SARS-CoV-2, elle révèle 99 chromosomes humains avec une correspondance d’identité de séquence à 100%. L’Orf1ab (gène E) renvoie 90 avec une correspondance d’identité de séquence de 100% avec les chromosomes humains.

Faire de même pour ces séquences avec une recherche microbienne trouve 92 microbes avec une correspondance à 100% avec le gène SARS-CoV-2 E et 100 microbes correspondants, avec une identité de séquence à 100%, avec le gène vital SARS-CoV-2 RdRp.

Chaque fois que nous vérifions les marqueurs génétiques dits uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, censées identifier le SRAS-CoV-2, ne sont pas uniques. Il peut s’agir de n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les  soi- disant  vérificateurs de faits , comme le  projet Health Feedback de Reuters  , ont rapidement rejeté les affirmations de  ceux qui ont remarqué le manque apparent de spécificité dans le génome supposé du SRAS-CoV-2.

En utilisant une multitude d’arguments d’homme de paille comme,  «cette affirmation suggère que chaque test devrait être positif»  (ce qui n’est pas le cas), leur   tentative de  démystification exécute quelque chose comme ceci :

Les amorces sont conçues pour se lier à des séquences nucléotidiques spécifiques qui sont uniques au virus. L’amorce sens peut se lier à un chromosome particulier, mais l’amorce inverse ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. De plus, parce que les amorces sens et pervers enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble délibérément déformer la signification de ces conclusions en transmettant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont  enquêté sur l’épidémiologie  des cas présumés marocains   de SRAS-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de le dire, beaucoup peuvent avoir été positifs pour aucun.

Ceci est entièrement conforme aux  directives de test de l’OMS . Ils déclarent:

«Un diagnostic optimal consiste en un NAAT [test d’amplification d’acide nucléique] avec au moins deux cibles indépendantes du génome du SRAS-CoV-2; cependant, dans les régions où la transmission est répandue, un algorithme simple à cible unique peut être utilisé… Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs de faits bien financés  ,  si les amorces avant et arrière identifient des indésirables, peut-être l’un étant le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée entre eux est probablement également indésirable.

L’argument selon lequel la RT-PCR ne trouve que l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression génique. Personne ne dit que des chromosomes entiers ou des microbes sont séquencés dans le génome présumé du SRAS-CoV-2. Bien qu’ils puissent, pour tout ce que nous savons. Ils disent que les marqueurs présumés, utilisés pour tester ce supposé virus, ne sont pas adaptés.

Les tests RT-PCR ne séquencent pas le génome entier. Ils recherchent des incidents de fluorescence de sonde spécifique pour indiquer la présence de séquences dites exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et sondes ne pouvaient rien révéler d’autre que des correspondances d’ARN extraites d’  ADN non codant, parfois appelé  «indésirable», ADN (ADNc).

Par exemple, le  gène SARS-CoV-2 S  est censé être hautement spécifique du génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité à 100%. La correspondance de pourcentage d’identité la plus faible, parmi les 100 premiers, est de 95%. Un BLAST du génome humain trouve également une correspondance de séquence à 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement ce que c’est. Le génome entier pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve que le SRAS-CoV-2 existe. Par conséquent, il n’y a pas non plus de preuve qu’une maladie appelée COVID 19 existe.

Cela signifie qu’il n’y a aucune base scientifique pour toute allégation concernant le nombre de cas de COVID 19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour  lutter contre  ce  virus mortel  sont très probablement fondées sur rien.

FRAUDE CONCLUANTE

La fraude est un acte criminel. La  définition juridique  de la fraude est:

«Une pratique frauduleuse ou un acte délibéré, auquel on a eu recours avec l’intention de priver un autre de ses droits ou, d’une manière ou d’une autre, de lui causer des blessures.»

La définition légale d’un complot est:

« Une combinaison ou une confédération entre deux ou plusieurs personnes constituées en vue de commettre, par leurs efforts conjoints, un acte illégal ou criminel »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont fourni aucune preuve pour montrer qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID 19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut le lire.

Pour qu’il y ait fraude, la tromperie doit être volontaire. L’intention doit être de priver délibérément autrui de ses droits ou de lui porter atteinte d’une autre manière. S’il existe des preuves de collusion entre des individus et / ou des organisations pour commettre une fraude, il s’agit alors d’un complot (dans les juridictions de common law) ou d’une  entreprise criminelle commune  (ECC) en vertu du droit international.

Il semble que COVID 19 a été délibérément utilisé comme  casus belli  pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté d’errer restreinte, la liberté de parole et d’expression érodée, les droits de manifester restreints, séparés de nos proches, nos entreprises détruites, psychologiquement bombardées, muselées et terrorisées.

Pire encore, bien qu’il n’y ait  aucune preuve  de   mortalité toutes causes sans précédent , il y a eu des pics de décès non saisonniers. Celles-ci  correspondent précisément aux mesures de verrouillage  qui ont vu le retrait des services de santé pour lesquels nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire du COVID 19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’  humanité elle-même .

Pour être  autorisés  à participer à leur soi-disant  «nouvelle normalité»,  qui est la transformation globale de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci incluent, mais sans s’y limiter, la surveillance bio-métrique de tout le monde, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une revendication effective que nous n’avons pas droit à la souveraineté sur nos propres organes. Ceci constitue la  condition de l’esclavage .

Il ne fait aucun doute que nous avons été privés de nos droits et lésés. Dans les juridictions de common law, l’innocence est présumée, mais la preuve qu’un préjudice a été délibérément causé par un complot international est accablante. Les politiques destructrices, adoptées par les gouvernements du monde entier, sont clairement nées des groupes de réflexion mondialistes et des institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont collectivement été incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le COVID 19 est un mythe.

Les responsables du crime de complot en vue de commettre une fraude mondiale devraient être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que nous autres essayons de réparer les dommages qu’ils ont déjà infligés.

Article complémentaire montrant que le virus n’a jamais été isolé.

Encore un article de Réseau International sur le même sujet

Et si le virus n’existait pas ?

Selon l’étude (en anglais) que vous pouvez télécharger ci-dessous, le test PCR ne détecte pas le SRAS-COV2 !

Extraits traduits:

Les séquences génétiques utilisées dans les PCR pour détecter une suspicion de SRAS-CoV-2 et pour diagnostiquer des cas de maladie et de décès attribués au Covid-19 sont présents dans des dizaines de séquences du génome humain lui-même et dans ceux d’une centaine de microbes.
Et cela inclut les initiateurs ou amorces, les fragments les plus étendus pris au hasard de leur supposé « génome » et même les soi-disant « gènes cibles » prétendument spécifiques au « nouveau coronavirus « . Le test est sans valeur et tous les résultats » positifs « obtenus jusqu’à présent devraient être scientifiquement invalidés et communiqués aux personnes concernées; et s’ils sont décédés, leurs proches.
Stephen Bustin, l’un des plus grands experts mondiaux de la PCR, dit en fait que sous certaines conditions, tout le monde peut être testé positif!

En conclusion: La conséquence de tout ce que nous venons d’expliquer est claire et immédiate: IL N’Y A PAS DE TEST VALIDE POUR DÉTECTER LE SARS-COV-2, ni tests d’anticorps ou d’antigènes ni RT-PCR. Et nous avons inclus ceux basés sur le gène supposé qui code pour la protéine S1 ou spike. Et cela signifie que TOUS LES NOMBRES DE «CAS», «INFECTÉ», «MALADE», «Asymptomatique» OU «MORT DUE POUR COVID-19 « MANQUE DE BASE SCIENTIFIQUE ET TOUS LES » POSITIFS « SONT FAUX POSITIFS, quelque chose qui devrait être communiqué immédiatement aux personnes concernées et aux autorités responsables qui devraient en être tenues pour responsables.

Au vu des développements aberrants des mesures prises pour soi-disant lutter contre ce virus, ses deuxième, troisième, … pseudo vagues tous basés sur ce test PCR, je commence sérieusement à me dire que ce virus n’existe pas.

Dans ce sens, il me semble opportun de reprendre ici une vidéo de Jean-Jacques Crèvecoeur du mois de juillet, où il étudiait l’hypothèse que ce virus n’existe pas.

Voir aussi la vidéo de David Icke sur le même thème.

Pour tenter de comprendre l’origine du virus

Pour les esprits passionnés et investigateurs, un excellent dossier de France Soir en partenariat avec bonsens.org en une bonne dizaine d’articles (parfois très complexes dans les derniers chapitres) pour se faire une bonne idée des pistes de recherche de l’origine de ce virus et éventuellement des mesures paranoïaques prises par les gouvernements.
En voici la liste des chapitres:

Chapitre 1
Traite de façon exhaustive la question de l’épicentre initial de la pandémie de Covid-19

Chapitre 2 (partie 1)
La face cachée du laboratoire P4 de Wuhan

Chapitre 2 (partie 2)
A la recherche du laboratoire P4 perdu de Wuhan – Fiasco géopolitique de la France

Chapitre 3 (partie 1)
Les virus synthétiques mutés et hybrides, à l’instar du virus COVID créé par Shi Zheng Li, représentent un danger réel qui plane sur une humanité anesthésiée par la désinformation

Chapitre 3 (partie 2)
Le virus synthétique hybride de Shi Zheng Li et Ralph Baric, une étape de plus franchie vers un monde nouveau d’insécurité biologique

Chapitre 4 (partie 1)
Les virus de Zhoushan – partie émergée de l’iceberg de la recherche militaire chinoise ?

Chapitre 4 (partie 2)
Les chauves-souris – réservoir naturel ancestral des coronavirus infectant l’Homme

Chapitre 4 (partie 3)
Le virus à l’origine de l’épidémie de 2002-2003 identifié dans une colonie de chauves-souris du Yunnan

Chapitre 4 (partie 4)
Les virus militaires de Zhoushan

Chapitre 5 (partie 1)
Les propriétés d’infectiosité et de réplication hors norme du SARS-Cov2 sont-elles à l’origine de la paranoïa de nos élites gouvernementales ?

Chapitre 5 (partie 2)
Les intercalations erronées conduisent à des mutations du virus qui sont réparées par une enzyme spécifique, unique aux SARS-Cov1 et SARS-Cov2

La page de bonsens.org consacrée à ce sujet.