Le scandale des tests PCR encore démontré

Ricardo révèle que des tests belges de la société Medakit (sérologie en 5 minutes, antigène en 30 secondes) ont été validés par toute une série d’organismes officiels. Il ne coûte presque rien mais hélas il ne rapporte rien à l’état, aux labos, …. Le directeur de cette société a été arrêté plusieurs fois !

https://laminutedericardo.com/LMDR/scoop-scandale-autour-des-tests-pcr/

L’interview complète du directeur de Medikit, Frédéric Baugniet

Questions sur les écouvillons des tests PCR ?

Est-on en droit de se poser la question sur la nature réelle de ces soi-disant prélèvements de matériel viral ? Il faut garder un esprit critique mais aussi ne pas fuir toute une série d’interrogations légitimes.
Alors ces types de prélèvements nécessaires non seulement pour prélever du matériel viral,
– ou déposer des nanoparticules et dans quel but ?,
– ou faire un relevé massif d’ADN pour constituer des bases de données de génômes humains avec des visées eugéniques ?
– ou vakxiner ?
– ou … ?

https://odysee.com/@EspritQritique:2/le-test-pcr-dr-buttar:3

La dictature des tests

Cette vidéo très pédagogique revient sur ce qu’est réellement un test. On va voir qu’un test ne permet jamais d’avoir la certitude qu’une personne est saine ou malade. Un test est juste un indice qui fait partie de l’ensemble du diagnostic. Regarder uniquement le résultat d’un test RT-PCR ne permet pas de savoir si une personne est malade ou non, ni même de savoir si une personne est contagieuse ou non.
Sachant cela, on verra qu’il est impossible de se servir des résultats de tests RT-PCR pour savoir ce qu’il se passe dans le pays. Au mieux, ça donne une petite idée des tendances. Dans tous les cas, baser les décisions de mesures aussi radicales que le confinement là-dessus, c’est soit une incompréhension totale de ce chiffre, soit une excuse bidon. Les tests sont un élément pour mieux soigner individuellement les gens.
S’en servir de socle pour un politique générale, c’est stupide et dangereux.

La brillante et percutante analyse par le Professeur Dolores Cahill, de la gestion de cette crise

Entrevue à ne pas rater et à visualiser dans son entièreté.

Le professeur Dolores Cahill de formation en biologie moléculaire et en immunologie, est professeur en recherche de transfert de découvertes scientifiques du domaine de la santé dans la société pour aider les gouvernements à définir des politiques. Elle a une expérience de plus de 25 ans notamment au sein de l’Institut Max Planck de Berlin et a été conseillère et coordinatrice au niveau de l’UE sur les aspects de la recherche et de l’innovation et leur implications sur les politiques.
C’est sans concession qu’elle analyse la gestion de tous les aspects de cette crise, au niveau des réelles responsabilités tant du point de vue scientifique que politique.

Quelques extraits parmi beaucoup d’autres très percutants:

… une proportion énorme, significative des publications étaient incorrectes et qu’il y avait de la résistance à l’intérieur de la communauté scientifique et de chercheurs à corriger cela.

Il y a 20 ans j’ai conseillé des gouvernements et j’ai constaté qu’un grand nombre de papiers étaient incorrects et que cela conduisait à des décisions gouvernementales incorrectes.

Il n’y a pas besoin de confinement, de distanciation physique ni de masques alors que des traitements efficaces étaient connus depuis le début.

Pour chaque mois de confinement, chaque personne perd un mois de vie.

Les test PCR devraient être séquencés … et qu’un test PCR positif ne veut rien dire et ne contient probablement pas le Sars Cov2 mais d’autres virus circulant.

En tant que Premier Ministre, vous ne pouvez pas déléguer la décision à un expert. Vous avez un job à faire en tant que 1er ministre et vous avez été élu pour analyser objectivement la situation et prendre toutes les décisions que ce soit le confinement que le port du masque par les enfants et assumer toutes les conséquences de ces décisions.

Reiner Fuellmich, avocats et médecins contre l’arnaque du Covid-19

A ne pas rater!
Reiner Fuellmich, avocat exerçant en Allemagne et aux Etats-Unis et ayant notamment dirigé l’action contre la fraude des moteurs diesel de Volkswagen et dénonçant les fraudes de grands groupes internationaux comme la Deustche Bank. Il dénonce ici la grande fraude de cette épidémie du C0VlD à travers les faux tests PCR, les faux scientifiques, le vakx1 et les actions de grands groupes internationaux contre les institutions nationales.
Voir aussi la vidéo publiée précédemment sur ce blog et annonçant l’action juridique internationale pour crime contre l’humanité qu’il intente.

https://odysee.com/@JeanneTraduction:a/reiner:9

Add-on: interview de Dr Fuellmich par France Soir ce 21/12/2020

Voir aussi: Allemagne : démission du Pr Aigner, en désaccord avec la science pratiquée

Jusqu’à présent, il n’était pas possible de différencier de manière fiable les virus de la grippe et le SRAS-Cov-2 dans les procédures de test !

Un article du journal autrichien Wochenblick révèle que les tests PCR actuels ne savent pas différencier le Covid de la grippe !!!
Cela confirme d’autres articles de ce blog révélant que cette crise est basée sur du vent de chiffres faux.

En voici la traduction:

Pas possible jusqu’à présent? Un nouveau test devrait différencier le corona de la grippe

il y a 2 jours

La société française de diagnostic Biomerieux est fière d’avoir reçu la certification pour de nouveaux tests corona. Cela devrait bientôt permettre de différencier le virus corona de la grippe, rapporte l’ORF . Cela soulève la question: jusqu’à présent, n’avons-nous même pas été en mesure de distinguer corona des virus de la grippe?

Vous avez bien entendu: jusqu’à présent, il n’était pas possible de différencier de manière fiable les virus du rhume et le SRAS-Cov-2 dans les procédures de test. Déjà le 24 avril, le gourou controversé de la couronne allemande et maintenant playboy Dr. Christian Drosten dans un podcast sur les réactions croisées qui pourraient rendre une telle distinction impossible.

Les virus prédécesseurs provoquent des réactions croisées

En raison des virus prédécesseurs du virus corona, qui circulent depuis longtemps, de nombreuses personnes devraient déjà avoir des cellules immunitaires contre lui. Dans une étude, Drosten a constaté que « 34 pour cent des patients ont des cellules T réactives [contre le SRAS-CoV-2 ], même si ces patients n’ont jamais eu de contact avec le virus du SRAS-2 ».

Apparemment, il n’a pas été possible pour la médecine de différencier le virus corona de la grippe conventionnelle (grippe). Sinon, le nouveau test de la société française ne serait pas une nouveauté.

L’entreprise promet des diagnostics meilleurs et plus rapides

Le directeur de la recherche de la société, François Lacoste, a déclaré que les tests « joueraient un rôle clé dans le début de l’hiver et de la saison grippale » . Parce que le test enregistre également d’autres maladies respiratoires avec des symptômes similaires.  À l’avenir, le test devrait être disponible dans tous les pays qui reconnaissent la certification «CE».

À l’aide d’un écouvillon nasal, les kits de test peuvent détecter les types de grippe A et B, Covid-19 et deux autres maladies virales.

Un nouveau test soulève des questions sur les tests de masse

Si, jusqu’à présent, les possibilités de différenciation entre les virus grippaux et corona n’ont pas été suffisantes, la question se pose de savoir ce qui a été déterminé dans les tests de masse (qui sont devenus le programme minoritaire) et si le nombre extrêmement petit de personnes qui ont été testées vraiment positives étaient réellement positives pour corona et n’a pas été testé pour les virus grippaux.

A rapprocher de l’article publié dans ce blog déjà le 5 septembre dernier intitulé Le laboratoire Roche crée un test antigénique pour différencier la grippe et le coronavirus/. Il s’agit probablement du même test ?

Toujours à propos de la non fiabilité des tests PCR, voir aussi un article de France Soir évoquant  qu’un tribunal portugais a jugé le 11 novembre dernier que les tests PCR sont « peu fiables » et les quarantaines « illégales » (totalement boycotté par la presse !).

Le scandale du coronavirus éclate en Allemagne. Faux positifs et test PCR Drosten

Un article de GlobalResearch de William Engdahl traduit pour France Soir challenge l’approche allemande de la gestion de la crise.

Voici la copie de cet article:

Le modèle allemand largement salué du régime d’Angela Merkel pour faire face à la pandémie de COVID-19 est maintenant englouti dans une série de scandales potentiellement dévastateurs allant au cœur même des tests et des conseils médicaux utilisés pour déclarer des fermetures économiques draconiennes et ensuite, vaccinations obligatoires de facto. Les scandales impliquent un professeur au cœur du groupe consultatif corona de Merkel. Les implications vont bien au-delà des frontières allemandes jusqu’à l’OMS elle-même et ses recommandations mondiales.

L’ensemble des arguments en faveur du confinement d’urgence mandaté par l’OMS des entreprises, des écoles, des églises et d’autres arènes sociales dans le monde repose sur un test introduit, étonnamment tôt, dans la saga des coronavirus de Wuhan, en Chine.

Le 23 janvier 2020, dans la revue scientifique Eurosurveillance , du Centre européen de prévention et de contrôle des maladies, le Dr Christian Drosten, ainsi que plusieurs collègues de l’Institut de virologie de Berlin à l’hôpital Charite, ainsi que le chef d’une petite société de biotechnologie berlinoise , TIB Molbiol Syntheselabor GmbH, a publié une étude affirmant avoir développé le premier test efficace pour détecter si une personne est infectée par le nouveau coronavirus identifié les premiers jours à peine à Wuhan. L’article de Drosten était intitulé «Détection du nouveau coronavirus 2019 (2019-nCoV) par RT-PCR en temps réel» (Eurosurveillance 25 (8) 2020).

La nouvelle a été immédiatement approuvée par le directeur général corrompu de l’OMS, Tedros Adhanom , le premier médecin non médical à diriger l’OMS. Depuis lors, le test de dépistage du virus soutenu par Drosten, appelé test en temps réel ou RT-PCR, s’est propagé via l’OMS dans le monde entier, en tant que protocole de test le plus utilisé pour déterminer si une personne pourrait avoir le COVID-19, la maladie.

Le 27 novembre, un groupe très respecté de 23 virologues, microbiologistes et scientifiques du monde entier a publié un appel à  Eurosurveillance  pour retirer l’article de Drosten du 23 janvier 2020. Leur analyse minutieuse de la pièce originale est accablante. Le leur est un véritable «examen par les pairs».

Ils accusent Drosten d’incompétence scientifique «fatale» et de failles dans la promotion de leur test.

Pour commencer, comme le révèlent les scientifiques critiques, le document qui a établi le test Drosten PCR pour la souche de coronavirus de Wuhan qui a ensuite été adopté avec une hâte indécente par le gouvernement Merkel avec l’OMS pour une utilisation mondiale – ce qui a entraîné de graves confinements dans le monde et une catastrophe économique et sociale – n’a jamais fait l’objet d’un examen par les pairs avant sa publication par la revue Eurosurveillance. Les critiques soulignent que :

«L’article de Corman-Drosten a été soumis à  Eurosurveillance  le 21 janvier 2020 et accepté pour publication le 22 janvier 2020. Le 23 janvier 2020, l’article était en ligne.»

Plus incroyable, le protocole de test Drosten, qu’il avait déjà envoyé à l’OMS à Genève le 17 janvier, a été officiellement recommandé par l’OMS comme test mondial pour déterminer la présence du coronavirus de Wuhan, avant même que l’article ne soit publié .

Comme le soulignent les auteurs critiques, pour un sujet si complexe et important pour la santé et la sécurité dans le monde, un «examen par les pairs» sérieux de 24 heures par au moins deux experts dans le domaine n’est pas possible. Les critiques soulignent que Drosten et son co-auteur, le Dr Chantal Reusken, n’ont pas révélé de conflit d’intérêts flagrant. Tous deux étaient également membres du comité de rédaction d’Eurosurveillance. Plus loin, comme le rapportent la BBC et Google Statistics, le 21 janvier, il y avait un total mondial de 6 décès attribués au virus de Wuhan. Ils demandent : «Pourquoi les auteurs ont-ils assumé un défi pour les laboratoires de santé publique alors qu’il n’y avait aucune preuve substantielle à ce moment-là pour indiquer que l’épidémie était plus répandue qu’on ne le pensait initialement ?» Un autre co-auteur de l’article Drosten qui a donné une couverture de crédibilité scientifique apparente à la procédure de PCR Drosten était le chef de la société qui a développé le test commercialisé aujourd’hui, avec la bénédiction de l’OMS, par centaines de millions, Olfert Landt, de tib-MOLBIOL à Berlin, mais Landt n’a pas révélé ce fait pertinent dans le document Drosten.

Certainement rien de suspect ou d’incorrect jusqu’ici.  Il serait pertinent de savoir si Drosten, le conseiller scientifique en chef de Merkel pour COVID-19, le «Tony Fauci» allemand de facto, obtient un pourcentage sur les ventes de chaque test vendu par Tib-Molbiol dans leur accord de marketing mondial avec Roche.

Faux positifs ?

Depuis fin janvier 2020, les médias grand public du monde nous inondent tous de mises à jour effrayantes toutes les heures sur «le nombre total de coronavirus infectés». Habituellement, ils ajoutent simplement chaque augmentation quotidienne à un total mondial de «cas confirmés», actuellement plus de 66 millions. Alarmant, mais pour le fait que, comme le soulignent Pieter Borger et ses collègues collaborateurs scientifiques, les «cas confirmés» sont un nombre insensé. Pourquoi ?

L’examen externe par des pairs du test RT-PCR pour détecter le SRAS-CoV-2 révèle 10 failles scientifiques majeures au niveau moléculaire et méthodologique : conséquences des faux résultats positifs

Le rapport Borger identifie ce qu’ils appellent «dix problèmes mortels» dans le journal Drosten de janvier dernier. Nous reprenons ici le plus flagrant qui puisse être facilement saisi par la plupart des profanes.

Drosten & co. a donné des séquences d’amorce et de sonde non spécifiées déroutantes. Les critiques notent : «Ce nombre élevé de variantes est non seulement inhabituel, mais il est également très déroutant pour les laboratoires. Ces six positions non spécifiées pourraient facilement aboutir à la conception de plusieurs séquences d’amorces alternatives différentes qui ne se rapportent pas au SARS-CoV-2. la description confuse et non spécifique dans l’article de Corman-Drosten ne convient pas comme protocole opérationnel standard. Ces positions non précisées auraient dû être conçues sans équivoque. » Ils ajoutent que : 

«La RT-PCR n’est pas recommandée pour le diagnostic primaire de l’infection. C’est pourquoi le test RT-PCR utilisé en routine clinique pour la détection du COVID-19 n’est pas indiqué pour le diagnostic du COVID-19 sur une base réglementaire  . »

Cycles d’amplification

Mais ce qui est encore plus accablant pour Drosten, c’est le fait qu’il n’a mentionné nulle part qu’un test soit positif ou négatif, ni ce qui définit un résultat positif ou négatif ! Le rapport Borger note :

«Ces types de tests de diagnostic virologique doivent être basés sur un SOP (Standard Operational Protocol), comprenant un nombre validé et fixe de cycles PCR (valeur Ct) après lequel un échantillon est jugé positif ou négatif. 

La  valeur  Ct maximale raisonnablement fiable est de 30 cycles. Au-dessus d’un Ct de 35 cycles, il faut s’attendre à un nombre rapidement croissant de faux positifs. Des études scientifiques montrent que seuls les virus non infectieux (morts) sont détectés avec des valeurs de Ct de 35. » .

L’OMS et Drosten recommandent un Ct de 45 cycles et, semble-t-il, actuellement, les responsables de la Santé allemands le font également. Il n’est pas étonnant que, alors que le nombre de tests augmente au début de la saison grippale hivernale, les «positifs» PCR en Allemagne et ailleurs explosent. Comme le soulignent les auteurs critiques, si les autorités sanitaires devaient spécifier 35 cycles maximum, selon l’article de Jaafar à l’IHU à 35 cycles il ne reste plus que 3% de vrai positifs ! Ils notent, «un résultat analytique avec une valeur Ct de 45 est  scientifiquement absolument dénué de sens (une valeur Ct raisonnable ne doit pas dépasser 30). Tout cela doit être communiqué très clairement.

C’est une erreur importante que l’article de Corman-Drosten ne mentionne pas la valeur Ct maximale à laquelle un échantillon peut être considéré sans ambiguïté comme un résultat de test positif ou négatif. Cette limite de seuil de cycle importante n’est pas non plus spécifiée dans les soumissions de suivi à ce jour. Les auteurs ajoutent :

«Le fait que ces produits de PCR n’aient pas été validés au niveau moléculaire est une autre erreur frappante du protocole, rendant  tout test basé sur celui-ci inutile en tant qu’outil de diagnostic spécifique pour identifier le virus SARS-CoV-2. »  

En clair, tout l’édifice de la fondation Gates, du gouvernement Merkel, de l’OMS et du WEF ainsi que le cas des vaccins de facto forcés non testés, repose sur les résultats d’un test PCR pour le coronavirus qui ne vaut pas une « cacahouète ». Le test de Drosten et de l’OMS est plus ou moins de la merde scientifique.

Une absence de preuve de son doctorat ?

Cette critique dévastatrice de vingt-trois scientifiques de premier plan, y compris des scientifiques titulaires de brevets liés à la PCR, à l’isolement et au séquençage de l’ADN, et d’un ancien scientifique en chef de Pfizer, est accablante, mais ce n’est pas le seul problème auquel le professeur Christian Drosten est confronté aujourd’hui. Lui et les fonctionnaires de l’Université Goethe de Francfort, où il affirme avoir obtenu son doctorat en médecine en 2003, sont accusés de fraude au diplôme.

Selon le Dr Markus Kühbacher, un spécialiste enquêtant sur la fraude scientifique telle que le plagiat de thèse, la thèse de doctorat du Dr Drosten devait être déposée à une certaine date auprès des autorités académiques de son université, qui signent ensuite un formulaire juridique, « Revisionsschein », avec une signature authentique, un cachet de l’Université et la date, avec le titre de la thèse et l’auteur, afin qu’elle soit envoyée aux archives de l’Université. Trois exemplaires originaux de la thèse devraient y être déposés.

Kühbacher accuse l’Université de Goethe d’être coupable de dissimulation en affirmant, à tort, que le Revisionsschein  (formulaire juridique) de Drosten  étaient au dossier. Le porte-parole de l’université a ensuite été contraint d’admettre qu’il n’avait pas été déposé, du moins pas localisable par eux. De plus, sur les trois copies de dossier obligatoires de sa thèse de doctorat, très pertinent compte tenu de l’importance mondiale du rôle de Drosten dans la gestion de la crise de coronavirus, deux copies ont «disparu» et la copie unique restante est endommagée par l’eau. Kühbacher dit que Drosten va probablement faire face à des poursuites judiciaires un titre de doctorat frauduleux.

De plus, le médecin allemand bien connu et critique, Dr Wolfgang Wodarg a engagé une procédure judiciaire pour calomnie et diffamation contre deux personnes responsables du site de média allemand, Volksverpetzer.de. Le Dr Wodard demande 250 000 € de dommages et intérêts pour diffamation au site ainsi qu’à d’autres médias allemands, affirmant qu’ils ont vicieusement et sans preuve, diffamé Wodarg, le qualifiant de « covid-denier », le qualifiant à tort d’extrémiste de droite (il est un ancien député du Parti social-démocrate depuis toujours) et de nombreuses autres accusations fausses et  préjudiciables .

L’avocat du Dr Wodarg est le Dr Reiner Fuellmich avocat germano-américain bien connu. Dans ses accusations contre la partie adverse, Fuellmich cite intégralement les accusations portées contre le test Drosten pour le coronavirus du Dr Pieter Borger et al notées ci-dessus. Cela oblige en fait les défendeurs à réfuter l’article de Borger. C’est une étape majeure sur la voie de la réfutation de toute la fraude au test PCR COVID-19 de l’OMS. Déjà une cour d’appel à Lisbonne, au Portugal, a statué le 11 novembre que le test PCR de Drosten et de l’OMS n’était pas valide pour détecter une infection à coronavirus et qu’il n’était pas fondé d’ordonner des verrouillages partiels ou à l’échelle nationale.

Si l’enjeu n’était pas si mortel pour l’humanité, tout serait de nature à être considéré comme une comédie absurde.  Le tsar de la santé mondiale, le chef de l’OMS (Organisation mondiale de la Santé) Tedros n’est pas un médecin mais i conseille le gouvernement Merkel sur les mesures COVID-19. L’OMS est pour sa part financée en grande partie par la fondation Gates.

Le gouvernement Merkel utilise le test PCR de Drosten et Drosten comme un expert «avec beaucoup de sagesse» pour justifier d’imposer des mesures aux conséquences économiques les plus draconiennes hors temps de guerre. Son ministre de la Santé, Jens Spahn, est un ancien banquier qui n’a pas de diplôme de médecine, seulement un passage en tant que lobbyiste pour Big Pharma. Le chef du CDC allemand, appelé Institut Robert Koch, Lothar Wieler, n’est pas un virologue, mais un médecin animalier, Tierarzt. 

Avec cette équipe, les Allemands voient leur vie détruite par des confinements et des mesures sociales jamais imaginés auparavant. Il y a la science et puis il y a la science. Cependant, toute la «science» n’est pas valable.

Les Allemands avec 3 fois moins de décès que la France, sont bien plus critiques de la gestion de la crise que ne le sont les Français.  Un reveil attendu en France ?

Quel rôle l’Institut Pasteur a-t-il joué dans le contrôle de l’épidémie en France ?

Une analyse très documentée de France Soir sur le rôle de l’Institut Pasteur depuis le début de cette crise.
A mettre en relation avec les analyses du Professeur Fourtillan qui a déposé plainte contre l’institut Pasteur, suite à laquelle il a été interné de force dans un hôpital psychiatrique (affaire à suivre).

Début de l’article:

Lorsque les chercheurs de l’Institut Pasteur ont été questionnés sur la possibilité que le SARS-Cov2 soit un virus manipulé, ils ont répondu que si c’était le cas des vestiges de manipulations devraient se retrouver dans le génome. Ils entendaient par-là que, dans le cas d’un accident non intentionnel de laboratoire, la présence de sites de clivage d’enzymes de restriction devrait révéler la manipulation. Cependant, comme nous l’avons montré dans la première partie de ce chapitre qu’il est tout à fait possible depuis le début des années 2000 de manipuler des coronavirus entiers sans laisser de trace. Ils sont restés très discrets également sur la nouvelle technique de manipulation génétique CRISPR-Cas9. Elle permet ce que l’on appelle à présent l’édition de génome, tant la comparaison avec les logiciels qui permettent la modification rapide et simple d’un texte est tentante. Ils ne pouvaient pas l’ignorer. D’ailleurs, notons qu’ Emmanuelle Charpentier est un peu l’enfant prodige de l’Institut Pasteur puisqu’elle y a poursuivi des recherches doctorales entre 1992 et 1995.

Tout un chacun a pu constater le silence assourdissant de l’Institut Pasteur depuis le début de l’épidémie et les quelques réponses éparses obtenues sur la nature et l’origine du virus n’ont été que trop évasives et passablement trompeuses. Par exemple, l’affirmation que le virus SARSCov2 était très distinct du SARS-Cov est de toute évidence une contre-vérité sur le plan de la structure de son génome, de son organisation spatiale et de son mode de fonctionnement.

Il n’est pas concevable, qu’étant donné son rôle dans la détection et la prévention des épidémies, l’Institut Pasteur n’ait pas été au courant très tôt, dès les mois de décembre et janvier, du danger de cette épidémie. Pourquoi les gens de Pasteur n’ont-ils pas alerté les autorités françaises ou tenu une conférence de presse publique dès le courant janvier ?

Selon son site internet, l’Institut Pasteur abrite la « Cellule d’Intervention Biologique d’Urgence (CIBU), été créée fin 2002 sous l’impulsion du Directeur Général de la Santé (DGS) et du Directeur Général de l’Institut Pasteur, afin de répondre aux « urgences biologiques spécialisées ». Ces urgences peuvent être des épidémies, des accidents ou une utilisation potentielle d’armes d’origine biologique, toutes mettant en péril la santé publique. » Les missions de la CIBU incluent :

– mobiliser à l’international de l’expertise en cas d’urgence représentant une menace pour la sécurité sanitaire en France ;
– informer sans délai l’InVS en cas de détection de tout phénomène inhabituel susceptible d’avoir un impact sur la santé publique.

Que faisait son directeur, Jean-Claude Manuguerra, au cours du mois de janvier 2020, quand il a été mis au courant de la situation à Wuhan ? On l’a malheureusement vu déclaré le 21 janvier 2020 sur Euronews à propos de l’épidémie en Chine : «… c’est quelque chose de nouveau mais qui pour l’instant n’est pas plus préoccupante que ça. Il faut juste ne pas louper le coche pour endiguer ce phénomène épidémique …». S’il y avait une personne en France qui connaissait le danger de laisser pénétrer en France le SARS-Cov2 c’était bien lui.  La séquence du premier isolat WH-Human 1 du coronavirus (appelée aussi 2019-nCoV) et son génome complet  (29,903 nt) avait été déposé le 14 janvier 2020 dans GenBank, sous code d’accession MN908947 avec la définition « Génome complet de l’isolat du virus WH-Human 1 de pneumonie du marché aux fruits de mer de Wuhan ». Donc, la séquence du  virus avait forcément été analysée par les équipes de l’Institut Pasteur. Elles savaient à quel point le motif de liaison (RBM) de la protéine S était proche de celui du SARS-Cov de 2002-2003 ainsi que sa polymérase RdRp (96,5% d’identité) signant la dangerosité du virus. De plus, les autorités chinoises annonçaient le caractère contagieux du virus le 20 janvier, avec 1 mois de retard, alors que les autorités de Wuhan connaissaient le caractère contagieux depuis la mi-décembre (chapitre 1). Le 24 janvier il était publié dans le Lancet que le virus était transmissible de personne à personne. Le directeur de la CIBU savait donc le 21 janvier, lors de son interview sur Euronews, que ce nouveau virus était de type SARS-Cov avec tout ce que cela implique. Qu’a-t-il fait pour informer et alerter les pouvoirs publiques avec conviction durant la dernière semaine de janvier et tout le mois de février ?

Dans la section qui suit nous découvrons, qu’en compagnie de 15 autres chercheurs à l’Institut Pasteur, il est co-inventeur d’un brevet sur les vakx1s contre les virus du type SARS-Cov. Ce brevet prouve que Pasteur s’était préparé depuis 2003 à l’éventualité de la ré-émergence d’un virus similaire au SARS-Cov. Ils ont procédé à des milliers d’expériences pour comprendre comment faire des tests de dépistage et des vakx1s contre ce type de virus émergeant. Ils ont breveté le résultat de toutes ces expériences pour être en mesure, le cas échéant, de tirer les bénéfices financiers potentiels d’une épidémie de SARS-Cov qui ne serait pas maîtrisée à temps, nécessitant dépistage et vaccination massive. Cela, les dispensait-il de leur rôle d’alerte des pouvoirs publiques ?

Les brevets de portée mondiale de l’Institut Pasteur

L’Institut Pasteur détient depuis 2005 des brevets de portée mondiale (EP 1 694 829 B1 et US 2007/0128224 A1) sur les coronavirus à SARS. Ces brevets qui courent au moins jusqu’en 2027 ont pour but d’explorer et de décrire le maximum de caractéristiques de façon à établir des vakx1s ou des tests de dépistage sur des coronavirus de type SARS-Cov. Ces brevets se basent sur le séquençage d’un isolat complet du virus du SARS-Cov récupéré à la Clinique Française de Hanoï en février 2003. Cela était parfaitement légitime pour étudier la confection de vaccin contre l’éventualité d’une épidémie de coronavirus à SARS du type de celle de 2002-2003 dans les années à venir. Cependant, soyons clairs, le seul but d’un brevet est l’argent qui est le facteur numéro 1 de survie pour les instituts de recherche. Mais cela amène une grande confusion, et permet d’introduire le biais du conflit d’intérêt dans un domaine particulier de la santé publique (les épidémies) qui devrait en être intégralement exempt

Lire la suite de l’article complet sur France Soir

Les docteurs Wodarg et Yeadon demandent l’arrêt de toutes les études sur la vaccination contre la corona et appellent à cosigner la pétition

Le Dr Michael Yeadon, ancien chef du département de recherche sur les maladies respiratoires chez Pfizer, et le Dr Wolfgang Wodarg, pneumologue et ancien chef du département de santé publique, ont déposé le 1er décembre 2020 auprès de l’EMA, l’Agence européenne des médicaments responsable de l’approbation des médicaments à l’échelle de l’UE, une demande de suspension immédiate de toutes les études sur le vaccin CoV-2 contre le SRAS, en particulier l’étude BioNtech/Pfizer sur le BNT162b (numéro EudraCT 2020-002641-42).

Les docteurs Wodarg et Yeadon demandent que, pour la protection de la vie et de la santé des volontaires, les études ne soient pas poursuivies tant que l’on ne disposera pas d’un plan d’étude adapté pour répondre aux préoccupations importantes en matière de sécurité exprimées par un nombre croissant de scientifiques de renom à l’encontre du vaccin et du plan d’étude.

D’une part, les pétitionnaires demandent qu’en raison du manque connu de précision du test PCR, une étude sérieuse doit utiliser un séquençage dit de Sanger. C’est la seule façon de faire des déclarations fiables sur l’efficacité d’un vaccin contre le Covid-19. Sur la base des nombreux tests PCR de qualité très différente, ni le risque de maladie ni un éventuel bénéfice du vaccin ne peuvent être déterminés avec la certitude nécessaire, c’est pourquoi tester le vaccin sur l’homme est en soi contraire à l’éthique.

En outre, ils exigent qu’il soit exclu, par exemple par le biais de l’expérimentation animale, que des risques déjà connus par des études antérieures, qui découlent en partie de la nature des virus corona, puissent être réalisés. Les préoccupations portent notamment sur les points suivants:

La formation d’anticorps dits “non neutralisants” peut entraîner une réaction immunitaire exagérée, surtout lorsque la personne testée est confrontée au vrai virus “sauvage” après la vaccination. Cette amplification dite dépendante des anticorps, l’ADE, est connue depuis longtemps grâce à des expériences sur les vaccins corona chez les chats, par exemple. Au cours de ces études, tous les chats qui avaient initialement bien toléré la vaccination sont morts après avoir attrapé le virus sauvage.

Les vaccinations devraient produire des anticorps contre les protéines de pointe du SRAS-CoV-2. Cependant, les protéines de pointe contiennent également des protéines homologues de la syncytine, qui sont essentielles à la formation du placenta chez les mammifères tels que l’homme. Il doit être absolument exclu qu’un vaccin contre le SRAS-CoV-2 déclenche une réaction immunitaire contre la syncytine 1, car sinon une stérilité de durée indéterminée pourrait entraîner la vaccination des femmes.

Les vaccins à ARNm de BioNTech/Pfizer contiennent du polyéthylène glycol (PEG). 70% des personnes développent des anticorps contre cette substance – cela signifie que de nombreuses personnes peuvent développer des réactions allergiques, potentiellement mortelles, à la vaccination.

La durée beaucoup trop courte de l’étude ne permet pas une estimation réaliste des effets tardifs. Comme pour les cas de narcolepsie après la vaccination contre la grippe porcine, des millions de personnes en bonne santé seraient exposées à un risque inacceptable si une autorisation d’urgence était accordée et la possibilité d’observer les effets tardifs seulement à ce moment-là.Néanmoins, BioNTech/Pfizer a apparemment soumis une demande d’autorisation d’urgence le 1er décembre 2020.

APPEL À L’AIDE : le Dr Wodarg et le Dr Yeadon demandent au plus grand nombre possible de citoyens de l’UE de cosigner leur pétition en envoyant le courriel préparé ici à l’EMA.

Nachtrag: Wegen teilweiser Überlastung der Server hier der Inhalt der E-Mail und die Kontaktadressen zum späteren Selbst-Versenden: 

An: press@ema.europa.eu; petitionEMA@corona-ausschuss.com

Betreff: Co-signing the petition of Dr. Wodarg, Germany, and Dr. Yeadon, UK (submitted on 1-Dec-2020)

Dear Sir or Madam, I am hereby co-signing the petition of Dr. Wodarg and Dr. Yeadon to support their urgent request to stay the Phase III clinical trial(s) of BNT162b (EudraCT Number 2020-002641-42) and other clinical trials. The full text of the petition of Dr. Wodarg and Dr. Yeadon can be found here: https://2020news.de/wp-content/uploads/2020/12/Wodarg_Yeadon_EMA_Petition_Pfizer_Trial_FINAL_01DEC2020_EN_unsigned_with_Exhibits.pdf I hereby respectfully request that EMA act on the petition of Dr. Wodarg and Dr. Yeadon immediately. Regards 

Pour lire l’article sur le site 2020News.de…

Le Dr Pascal Sacré livre son analyse en toute liberté.

Le Dr Pascal Sacré, licencié pour s’être exprimé sur la non fiabilité des tests PCR notamment, livre toutes ses opinions lors d’une interview pour Kairos Presse. Il s’y exprime sur la gestion générale de la médecine, les tests, la fausse épidémie du Covid, les vaks1, la corruption de la médecine et des gouvernants, ….

Suite à cet interview, le Docteur Sacré a lancé un appel à la désobéissance civile dans la vidéo Facebook suivante:

https://fb.watch/23Qab48cZL/

Le confinement en question : des professionnels de santé posent un regard différent

Un montage vidéo d’Eric Remacle

La preuve de l’immunité collective en quelques graphiques

Lettre Santé Corps Esprit de Xavier Bazin du 25 novembre 2020.

Cher(e) ami(e) de la Santé,
Il n’y a strictement plus aucune bonne raison de confiner, en FranceLe confinement cause des dégâts économiques majeurs et des ravages sur la santé mentale des Français.Les avantages ? Il n’y en a aucun, en ce moment.Sur LCI, le journalise David Pujadas a eu l’honnêteté de l’expliquer clairement.Regardez la vidéo, elle dure 2 minutes et en vaut la peine :https://www.youtube.com/watch?v=Po1cGksY40c
Son premier argument est celui-ci: le pic des contaminations a eu lieu le 2 novembre, soit le 4ème jour seulement du confinement. Impossible, donc, que la baisse puisse être causée par le confinement, qui prend toujours plus de temps à faire son œuvre.Il suffit de regarder ce qui s’est passé en mars-avril dernier : le confinement n’a absolument pas enrayé l’épidémie, qui a mis encore plus de 2 semaines à atteindre son pic :
Mars avril
D’ailleurs, déjà au printemps dernier, il n’y avait pas de preuve que la décrue était seulement liée au confinement. Car la Suède a aussi atteint son pic épidémique à peu près au même moment, en avril, alors qu’elle a refusé de confiner sa population ! En voici la preuve, avec le nombre de morts de mars à juillet en Suède :
Nombre de morts Suède
Donc, ce n’est pas le confinement qui explique le recul spectaculaire du nombre de cas et d’hospitalisations. Du coup, certains au gouvernement aimeraient nous faire croire que cette décrue est liée au couvre-feu. C’est assez étrange d’imaginer qu’une mesure aussi « faible » pourrait avoir un impact aussi fort. Mais si vous aviez un doute, sachez que la baisse a été la même dans les communes frappées par le couvre-feu et dans celles qui n’étaient pas concernées !
Donc, le couvre-feu n’y est pour rien. Alors pourquoi cette baisse ? D’où vient-elle ? Et d’ailleurs, pourquoi étions-nous nombreux à l’avoir anticipée, en disant que reconfiner était inutile ?
La raison tient en deux mots : immunité collective. Regardez ce qui se passe dans le grand Est et en Ile de France. Si cette deuxième épidémie ne m’a jamais inquiétée, c’est parce que j’avais les yeux rivés sur ce qui se passait en Ile de France et dans le Grand Est, les deux régions les plus touchées en mars-avril. Or depuis le début de l’automne, je vois que les chiffres sont bons, dans ces deux régions. La semaine dernière, le Canard Enchaîné a fini par publier un article sur ce phénomène :« En octobre, avant même le couvre-feu et le reconfinement, les experts avaient constaté que le nombre d’infections et d’hospitalisations augmentait moins vite en Ile de France que presque partout ailleurs sur le territoire. La capitale et sa banlieue affichaient alors des taux d’incidence du virus presque deux fois inférieurs à ceux de Lyon, des deux Savoie ou de Saint-Etienne, qui avaient été pratiquement épargnés au printemps ».
Et le journal enfonce le clou :« Le phénomène s’est révélé plus frappant encore dans Paris intra-muros, qui, avec la Seine-Saint-Denis, a été la zone francilienne la plus touchée en mars et en avril.La baisse atteignait déjà 20 % le 2 novembre, et le phénomène continue depuis dans la ville la plus dense d’Europe, terrain de jeu idéal pour le coronavirus.La diminution, en revanche, apparaît plus faible au sein de la grande couronne moins peuplée et moins atteinte au printemps. »
Sans immunité collective, Paris, dense et très peuplée, aurait dû être lourdement frappée par la deuxième épidémie. Et pourtant, ce n’est pas le cas.

A l’inverse, les départements d’Ile-de-France moins touchés par l’épidémie au printemps auraient dû être davantage épargnés… et c’est le contraire qui s’est produit !Selon le Canard enchaîné, même le Pr Delfraissy, le très pessimiste président du Conseil scientifique, commence à envisager sérieusement l’hypothèse de l’immunité collective.
Mais pour moi, c’est plus qu’une hypothèse : c’est la seule explication possible à ce qu’on observe.
Regardez bien la forme des courbes d’hospitalisations en Ile de France et le grand Est, entre mars et aujourd’hui :
A gauche, on voit le pic épidémique de mars-avril, et à droite, une vague trois fois moins haute à l’automne. C’est le signe clair que ces deux régions largement touchées au printemps sont désormais relativement protégées contre une explosion des hospitalisations. Maintenant, regardez ce qui s’est passé en Rhône-Alpes et PACA, deux régions beaucoup moins touchées au printemps : c’est l’inverse !
Dans ces deux régions épargnées au printemps, la deuxième épidémie a causé deux fois plus d’hospitalisations que la première ! On ne peut pas avoir meilleure preuve de l’immunité collective.
Et la bonne nouvelle, c’est que le virus a désormais circulé largement, partout en France. Donc si on a une troisième épidémie en janvier prochain ou en octobre 2021, l’impact à attendre dans tout le pays sera logiquement encore plus faible que celui, très modéré, qu’on observe en ce moment en Ile-de-France et dans le grand Est. Même phénomène entre la Suède et la République Tchèque.
On observe les mêmes courbes inversées entre la Suède, qui n’a jamais confiné, et la République tchèque, qui s’est barricadée en mars-avril. En Suède, la deuxième épidémie fait peu de morts en ce moment, parce que l’immunité collective a commencé à jouer.
En République tchèque, au contraire, le pays a réussi à étouffer dans l’œuf l’épidémie au printemps, en fermant radicalement ses frontières… mais n’a rien pu faire à l’automne :
Vous noterez au passage qu’en Suède comme en République tchèque, la décrue de l’automne a commencé à peu près au même moment, comme dans tous les pays européens. Alors que ces pays ont des politiques de confinement et de masque très différentes ! Confinement ou pas confinement, l’épidémie est en décrue partout en Europe.
Même chose en Belgique : là-bas, la décrue est spectaculaire, et ne peut pas être liée au confinement, qui a été décidé après le pic épidémique :
Belgique
Et on observe le même phénomène dans les grandes capitales européennes, à Londres ou Rotterdam.Conclusions : RÉ-OUVRONS LE PAYS, VITE ! Tout ceci montre deux choses assez clairement : Les mesures comme le confinement ne peuvent pas grand-chose sur la dynamique de l’épidémie. Il est donc inutile de confiner, et il faut arrêter le massacre tout de suite.
Et surtout, on peut être très optimiste pour la suite ! Avec cette deuxième épidémie, les régions françaises comme PACA et Rhône-Alpes sont désormais au moins aussi bien « protégées » que l’Ile de France ou le Grand Est ! Cela veut dire qu’en cas de recrudescence prochaine, le système hospitalier ne sera pas engorgé – comme il a bien résisté cet automne à Paris, en Seine-Saint-Denis ou en Alsace. Il n’y a donc plus AUCUNE raison de priver les Français de leurs libertés fondamentales. Et il n’y a plus AUCUNE raison de vouloir les vacciner massivement, encore moins de force. Mais évidemment, vu les milliards déjà dépensés pour les vaccins, et le lobbying de Big Pharma, cela va causer de grosses tensions dans les mois qui viennent.
On en reparle très bientôt.
Bonne santé,
Xavier Bazin

Voir aussi l’article de France Soir: Deuxième vague conséquence directe du premier confinement

Un autre montage vidéo d’Eric Remacle sur les tests PCR

COVID19 – Preuve d’une fraude mondiale !

Lien vers l’article original du site OffGuardian.org avec tous les liens

Iain Davis

Le COVID 19 et les réponses gouvernementales ultérieures semblent faire partie d’un complot international en vue de commettre une fraude. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID 19.

Parfois, vous devez suivre votre instinct. Je ne suis pas un expert en génétique et, comme toujours, je dois être corrigé. Cependant, mon attention a été attirée sur certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur  conseil consultatif, composé  de médecins et de scientifiques éminemment qualifiés, confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction en anglais (voir le précédent article de eveilinfo.org avec la traduction en français )  de leur rapport et je  peux corroborer l’exactitude de leurs affirmations concernant les séquences nucléotidiques répertoriées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire la même chose.

D-Salud-Discovery indique qu’il n’y a pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du COVID 19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de COVID 19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de celui-ci.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve d’une pandémie, simplement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, autre que les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette  «classe de parasites»  a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’enquêtes et de poursuites devant un tribunal.

IDENTIFICATION DE QUOI EXACTEMENT?

L’Organisation mondiale de la santé (OMS) a  classé le COVID-19  (COronaVIrus Disease 2019). Ils ont déclaré une pandémie mondiale de COVID 19 le 11 mars 2019.

Les directives de l’OMS sur les  analyses de laboratoire  stipulent:

L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau bêtacoronavirus, (dans la même famille que le SRAS-CoV et le MERS-CoV) via le séquençage de nouvelle génération (NGS) à partir du virus de culture ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus SRAS-CoV-2  provoque la maladie COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de situation 1 sur le nouveau coronavirus 2019-nCov de l’OMS  , ils déclarent:

Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 …… Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays l’utilisent dans le développement de kits de diagnostic spécifiques.

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour étude), puis des séquences génétiques ont été  identifiées à  partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été développés et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et des chercheurs chinois, ces tests permettront de trouver le virus responsable du COVID 19.

Pourtant, l’OMS déclare également:

Travaillant directement à partir des informations de séquence, l’équipe a développé une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des  «informations de séquence»  car il n’y avait pas d’échantillon isolé et purifié du virus dit SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines hérissée contenant l’ARN viral).

Cependant, ces structures protéiques ne sont  pas uniques . Ils ressemblent à d’autres vésicules rondes, telles que les vésicules endocytaires et les exosomes.

Les virologues affirment qu’il n’est pas possible d ‘  «isoler»  un virus car ils ne se répliquent qu’à l’intérieur des cellules hôtes. Ils ajoutent que  les postulats de Koch  ne s’appliquent pas parce qu’ils concernent des bactéries (qui sont des organismes vivants). Au lieu de cela, les virologues observent les effets cytopathogènes (CPE) du virus, provoquant la mutation et la dégradation des cellules, dans les cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé pour  la première fois le génome complet du SRAS-CoV-2, ils ont observé le CPE dans les cellules Vero E6 et Huh7. Vero E6 est une lignée cellulaire de singe immortalisée et Huh7 sont des cellules cancéreuses immortalisées (tumorigènes). Cela signifie qu’ils ont été maintenus in vitro (dans des cultures de boîtes de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 est l’idée qu’il s’agit d’un virus zoonotique, capable de combler le fossé des espèces entre les animaux et les humains. Lorsque des  scientifiques du CDC américain ont  «infecté»  diverses cellules avec le nouveau virus, ils ont noté ce qui suit:

Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires de primates et humaines communes, y compris les cellules d’adénocarcinome humain (A549) [cellules pulmonaires], les cellules hépatiques humaines (HUH7.0) et les cellules rénales embryonnaires humaines ( HEK-293T), en plus de Vero E6 et Vero CCL81 [cellules de singe]… Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero [cellules de singe]… Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et Les cellules A549 [cellules du tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2. »

Le CDC n’a observé aucun CPE dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, suggérant qu’une infection d’un humain à l’autre serait impossible.

Notant ce problème, une équipe de scientifiques polonais a introduit ce «virus» séquencé   dans  les cellules de l’épithélium humain (voies respiratoires) . Ils ont observé les effets sur ces cultures d’AOH pendant 5 jours. Ils ont noté une réplication beaucoup plus grande que les scientifiques du CDC, mais ont finalement déclaré:

«Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’AOH.»

Cela signifie qu’ils n’ont vu aucune preuve des virions supposés rompant la membrane de la paroi cellulaire. Encore une fois, suggérant que ce soi-disant virus n’est pas infectieux chez l’homme.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer des maladies. Cela peut même ne pas exister physiquement. N’est-ce rien d’autre qu’un concept basé sur   des séquences génétiques prédictives ?

VOYAGE DE DÉCOUVERTE

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2  (MN908947.1). Cela a été mis à jour plusieurs fois. Cependant, MN908947.1 était la première séquence génétique décrivant l’ agent étiologique présumé du COVID 19   (SARS-CoV-2).

Toutes les déclarations, tests, traitements, statistiques, développement de vaccins et politiques qui en résultent sont basés sur cette séquence. Si les tests pour ce  nouveau  virus n’identifient rien de capable de provoquer des maladies chez les êtres humains, tout le récit du COVID 19 n’est rien d’autre qu’une mascarade.

Les  chercheurs de WUHAN ont déclaré  qu’ils avaient effectivement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques, découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé un  assemblage de novo  et une PCR ciblée et ont trouvé 29 891 paires de bases partageant une correspondance de séquence de 79,6% avec le SARS-CoV.

Ils ont dû utiliser l’  assemblage de novo  parce qu’ils n’avaient aucune  connaissance a  priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle des chercheurs chinois ont  isolé  le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome du coronavirus du SRAS publié (SARS-CoV). Malheureusement, la précision du génome original du SRAS-CoV n’est pas non plus claire.

En 2003, une équipe de  chercheurs de Hong Kong a  étudié 50 patients atteints du syndrome respiratoire aigu sévère (SRAS). Ils ont prélevé des échantillons de 2 de ces patients et ont développé une culture dans des cellules hépatiques de singe foetal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques  «d’origine inconnue».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il appartenait à la famille des Coronaviridae. Considérant que ces séquences suggéraient un virus SARS-CoV nouvellement découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré:

Les amorces de détection du nouveau virus ont été conçues pour la détection par RT-PCR de ce génome de coronavirus humain associé à la pneumonie dans des échantillons cliniques. Sur les 44 échantillons de nasopharynx disponibles auprès des 50 patients atteints du SRAS, 22 présentaient des preuves d’ARN de coronavirus humain associé à la pneumonie.

La moitié des patients testés, qui présentaient tous les mêmes symptômes, ont été testés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce  nouveau  virus SRAS-CoV. La question n’a pas été posée.

Ce virus supposé n’avait qu’une correspondance de séquence de 57% avec le coronavirus prétendument connu. Les 43% restants étaient simplement  «là».  Les données séquencées ont été produites et enregistrées en tant que nouveau génome sous le numéro d’ accès GenBank  AY274119 .

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement renommée SARS-CoV-2). Personne, à aucun stade de ce processus, n’avait produit d’échantillon isolé et purifié de quelque virus que ce soit. Tout ce qu’ils avaient était des correspondances de séquence de pourcentage avec d’autres correspondances de séquence de pourcentage.

N’ISOLER RIEN

Les scientifiques sont très ennuyés car ils n’arrêtent pas de dire que le virus a été isolé mais personne ne les croit. C’est parce que, pour l’instant, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images de virions du SRAS-C0V-2 de confirmer qu’il s’agissait d’images d’un virus isolé et purifié. Aucun d’eux ne le pouvait .

En Australie, des scientifiques du  Doherty Institute ont annoncé avoir  isolé  le virus SARS-CoV-2 . Lorsqu’on leur a demandé de clarifier les choses, les scientifiques ont déclaré:

«Nous avons des séquences courtes (ARN) du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic»

Cela explique pourquoi le  gouvernement australien  déclare:

La fiabilité des tests COVID-19 est incertaine en raison de la base de preuves limitée… Il existe des preuves limitées disponibles pour évaluer l’exactitude et l’utilité clinique des tests COVID-19 disponibles.

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a  écrit une lettre  au Premier ministre britannique Boris Johnson dans laquelle ils lui ont demandé de:

Produire des preuves scientifiques examinées par des pairs de manière indépendante prouvant que le virus Covid-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a  adressé une demande d’accès à l’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. À quoi  ils ont répondu :

PHE peut confirmer qu’il ne contient pas d’informations de la manière suggérée par votre demande. « 

La chercheuse canadienne Christine Massey a fait une demande similaire d’accès à l’information, demandant la même chose au gouvernement canadien. À quoi le  gouvernement canadien a répondu :

Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu localiser aucun document répondant à votre demande. »

Aux États-Unis, le panneau de diagnostic RT-PCR du Center for Disease Control (CDC)   indique:

… Aucun isolat viral quantifié du 2019-nCoV n’est actuellement disponible …… .. La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent causal des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur de tout patient déclaré atteint de la maladie du COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou provoque le COVID 19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Voir aussi: Dr. Tom Cowan w/ Jon Rappoport: SARS-CoV-2 Has Never Been Isolated, Is Only an Imaginary or Theoretical Virus, and, Therefore, No Test Can Detect It

TESTER POUR RIEN

L’OMS, et chaque gouvernement, groupe de réflexion, comité directeur des politiques, conseiller scientifique du gouvernement, institutions supranationales et autres qui promeuvent le récit officiel du COVID 19, affirment que le SRAS-CoV-2 cause le COVID 19.

Bien que personne n’ait jamais produit un échantillon de ce supposé virus, le génome présumé du SRAS-CoV-2  a été publié . C’est dans le domaine public.

On dit que les séquences génétiques clés  du génome du SRAS-CoV-2 ont des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour  identifier  la présence du  «virus» . 

  • Ceux-ci incluent:
    • Gène ARN-polymérase (Rd-Rp) – Cela permet à l’ARN du SARS-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales atteintes de COVID 19.
    • Gène S (Orf2) – cette glycoprotéine forme le pic sur la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 sur les cellules, permettant à l’ARN à l’intérieur de l’enveloppe de la protéine du virion (capside) de passer dans la  cellule maintenant  infectée .
    • Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage viral
    • Gène N (Orf9a) – le gène de la nucléocapside qui lie l’ARN dans la formation de la capside

L’OMS tient un  registre accessible au public  des amorces et sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences nucléotidiques spécifiques qui se lient (s’hybrident) aux brins antisens et sens de l’ADNc synthétisé (appelées respectivement amorces sens et inverse).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences nucléotidiques appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Lors de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, la sonde se désintègre en libérant un fluorescent ou un colorant qui peut ensuite être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

L’ outil de recherche d’alignement local de base  (BLAST) est un autre élément accessible au public  . Cela permet à quiconque de comparer les séquences nucléotidiques publiées avec toutes celles stockées par la base de données génétique des National Institutes of Health (NIH) des États-Unis appelée GenBank. Par conséquent, nous pouvons BLASTER les amorces, sondes et séquences de gènes cibles du SRAS-CoV-2 revendiquées.

Les protocoles d’amorces et de sondes sens et inverses de l’OMS pour le génome viral présumé du SRAS-CoV-2 sont basés sur les profils de gènes RdRp, Orf1, N et E. N’importe qui peut les exécuter via BLAST pour voir ce que nous trouvons.

La séquence nucléotidique vitale RdRP, utilisée comme amorce sens est – ATGAGCTTAGTCCTGTTG. Si nous exécutons un nucléotide BLAST, celui-ci est enregistré comme un isolat  complet de SARS-CoV-2  avec une identité de séquence à 100%. De même, la séquence d’amorce du gène E inverse – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui  identifie également  SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences nucléotidiques des génomes microbiens et humains. Si nous recherchons la séquence RdRp SARS-CoV-2, elle révèle 99 chromosomes humains avec une correspondance d’identité de séquence à 100%. L’Orf1ab (gène E) renvoie 90 avec une correspondance d’identité de séquence de 100% avec les chromosomes humains.

Faire de même pour ces séquences avec une recherche microbienne trouve 92 microbes avec une correspondance à 100% avec le gène SARS-CoV-2 E et 100 microbes correspondants, avec une identité de séquence à 100%, avec le gène vital SARS-CoV-2 RdRp.

Chaque fois que nous vérifions les marqueurs génétiques dits uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, censées identifier le SRAS-CoV-2, ne sont pas uniques. Il peut s’agir de n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les  soi- disant  vérificateurs de faits , comme le  projet Health Feedback de Reuters  , ont rapidement rejeté les affirmations de  ceux qui ont remarqué le manque apparent de spécificité dans le génome supposé du SRAS-CoV-2.

En utilisant une multitude d’arguments d’homme de paille comme,  «cette affirmation suggère que chaque test devrait être positif»  (ce qui n’est pas le cas), leur   tentative de  démystification exécute quelque chose comme ceci :

Les amorces sont conçues pour se lier à des séquences nucléotidiques spécifiques qui sont uniques au virus. L’amorce sens peut se lier à un chromosome particulier, mais l’amorce inverse ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. De plus, parce que les amorces sens et pervers enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble délibérément déformer la signification de ces conclusions en transmettant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont  enquêté sur l’épidémiologie  des cas présumés marocains   de SRAS-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de le dire, beaucoup peuvent avoir été positifs pour aucun.

Ceci est entièrement conforme aux  directives de test de l’OMS . Ils déclarent:

«Un diagnostic optimal consiste en un NAAT [test d’amplification d’acide nucléique] avec au moins deux cibles indépendantes du génome du SRAS-CoV-2; cependant, dans les régions où la transmission est répandue, un algorithme simple à cible unique peut être utilisé… Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs de faits bien financés  ,  si les amorces avant et arrière identifient des indésirables, peut-être l’un étant le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée entre eux est probablement également indésirable.

L’argument selon lequel la RT-PCR ne trouve que l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression génique. Personne ne dit que des chromosomes entiers ou des microbes sont séquencés dans le génome présumé du SRAS-CoV-2. Bien qu’ils puissent, pour tout ce que nous savons. Ils disent que les marqueurs présumés, utilisés pour tester ce supposé virus, ne sont pas adaptés.

Les tests RT-PCR ne séquencent pas le génome entier. Ils recherchent des incidents de fluorescence de sonde spécifique pour indiquer la présence de séquences dites exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et sondes ne pouvaient rien révéler d’autre que des correspondances d’ARN extraites d’  ADN non codant, parfois appelé  «indésirable», ADN (ADNc).

Par exemple, le  gène SARS-CoV-2 S  est censé être hautement spécifique du génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité à 100%. La correspondance de pourcentage d’identité la plus faible, parmi les 100 premiers, est de 95%. Un BLAST du génome humain trouve également une correspondance de séquence à 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement ce que c’est. Le génome entier pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve que le SRAS-CoV-2 existe. Par conséquent, il n’y a pas non plus de preuve qu’une maladie appelée COVID 19 existe.

Cela signifie qu’il n’y a aucune base scientifique pour toute allégation concernant le nombre de cas de COVID 19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour  lutter contre  ce  virus mortel  sont très probablement fondées sur rien.

FRAUDE CONCLUANTE

La fraude est un acte criminel. La  définition juridique  de la fraude est:

«Une pratique frauduleuse ou un acte délibéré, auquel on a eu recours avec l’intention de priver un autre de ses droits ou, d’une manière ou d’une autre, de lui causer des blessures.»

La définition légale d’un complot est:

« Une combinaison ou une confédération entre deux ou plusieurs personnes constituées en vue de commettre, par leurs efforts conjoints, un acte illégal ou criminel »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont fourni aucune preuve pour montrer qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID 19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut le lire.

Pour qu’il y ait fraude, la tromperie doit être volontaire. L’intention doit être de priver délibérément autrui de ses droits ou de lui porter atteinte d’une autre manière. S’il existe des preuves de collusion entre des individus et / ou des organisations pour commettre une fraude, il s’agit alors d’un complot (dans les juridictions de common law) ou d’une  entreprise criminelle commune  (ECC) en vertu du droit international.

Il semble que COVID 19 a été délibérément utilisé comme  casus belli  pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté d’errer restreinte, la liberté de parole et d’expression érodée, les droits de manifester restreints, séparés de nos proches, nos entreprises détruites, psychologiquement bombardées, muselées et terrorisées.

Pire encore, bien qu’il n’y ait  aucune preuve  de   mortalité toutes causes sans précédent , il y a eu des pics de décès non saisonniers. Celles-ci  correspondent précisément aux mesures de verrouillage  qui ont vu le retrait des services de santé pour lesquels nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire du COVID 19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’  humanité elle-même .

Pour être  autorisés  à participer à leur soi-disant  «nouvelle normalité»,  qui est la transformation globale de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci incluent, mais sans s’y limiter, la surveillance bio-métrique de tout le monde, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une revendication effective que nous n’avons pas droit à la souveraineté sur nos propres organes. Ceci constitue la  condition de l’esclavage .

Il ne fait aucun doute que nous avons été privés de nos droits et lésés. Dans les juridictions de common law, l’innocence est présumée, mais la preuve qu’un préjudice a été délibérément causé par un complot international est accablante. Les politiques destructrices, adoptées par les gouvernements du monde entier, sont clairement nées des groupes de réflexion mondialistes et des institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont collectivement été incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le COVID 19 est un mythe.

Les responsables du crime de complot en vue de commettre une fraude mondiale devraient être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que nous autres essayons de réparer les dommages qu’ils ont déjà infligés.

Article complémentaire montrant que le virus n’a jamais été isolé.

Encore un article de Réseau International sur le même sujet

Et si le virus n’existait pas ?

Selon l’étude (en anglais) que vous pouvez télécharger ci-dessous, le test PCR ne détecte pas le SRAS-COV2 !

Extraits traduits:

Les séquences génétiques utilisées dans les PCR pour détecter une suspicion de SRAS-CoV-2 et pour diagnostiquer des cas de maladie et de décès attribués au Covid-19 sont présents dans des dizaines de séquences du génome humain lui-même et dans ceux d’une centaine de microbes.
Et cela inclut les initiateurs ou amorces, les fragments les plus étendus pris au hasard de leur supposé « génome » et même les soi-disant « gènes cibles » prétendument spécifiques au « nouveau coronavirus « . Le test est sans valeur et tous les résultats » positifs « obtenus jusqu’à présent devraient être scientifiquement invalidés et communiqués aux personnes concernées; et s’ils sont décédés, leurs proches.
Stephen Bustin, l’un des plus grands experts mondiaux de la PCR, dit en fait que sous certaines conditions, tout le monde peut être testé positif!

En conclusion: La conséquence de tout ce que nous venons d’expliquer est claire et immédiate: IL N’Y A PAS DE TEST VALIDE POUR DÉTECTER LE SARS-COV-2, ni tests d’anticorps ou d’antigènes ni RT-PCR. Et nous avons inclus ceux basés sur le gène supposé qui code pour la protéine S1 ou spike. Et cela signifie que TOUS LES NOMBRES DE «CAS», «INFECTÉ», «MALADE», «Asymptomatique» OU «MORT DUE POUR COVID-19 « MANQUE DE BASE SCIENTIFIQUE ET TOUS LES » POSITIFS « SONT FAUX POSITIFS, quelque chose qui devrait être communiqué immédiatement aux personnes concernées et aux autorités responsables qui devraient en être tenues pour responsables.

Au vu des développements aberrants des mesures prises pour soi-disant lutter contre ce virus, ses deuxième, troisième, … pseudo vagues tous basés sur ce test PCR, je commence sérieusement à me dire que ce virus n’existe pas.

Dans ce sens, il me semble opportun de reprendre ici une vidéo de Jean-Jacques Crèvecoeur du mois de juillet, où il étudiait l’hypothèse que ce virus n’existe pas.

Voir aussi la vidéo de David Icke sur le même thème.

Toujours l’aspect spécieux des tests PCR.

Extrait de l’article de France Soir de ce 5/11, intitulé « Avec les tests Véran PCR, restez confinés tout l’hiver » qui montre bien que ces tests sont utilisés avec un objectif politique.


Sur le même sujet, vous trouverez aussi ci-dessous, les réponses aux questions que j’avais envoyées par mail à Clémence Richetta, Maître de Conférence à l’Ecole Normale Supérieure de Paris-Saclay, suite à une vidéo où elle expliquait la technologie des tests PCR.
Ces réponses indiquent notamment qu’il y a en France, 96 tests différents et que chaque labo définit son protocole et ses amorces. Une aubaine pour continuer un business qui marche ! Une sérieuse enquête scientifique, judiciaire et indépendante (?) serait bien nécessaire pour démasquer les manipulations potentielles.

Extraits de l’article de France Soir

Comme démontré dans l’article précédent où l’on interrogeait ces tests PCR, les prélèvements effectués sur les patients contiennent de multiples fragments d’ARN : ARN de différents virus, de bactéries, ARN humain…Une part importante de ces fragments sont des des ARN inertes, des déchets. Il est probable, et même plus qu’évident au regard de la quantité et de la diversité des ARN présents (1), que certains fragments ARN puisent contenir des séquences communes à certaines séquences du Sars-CoV-2. Il est donc envisageable que certains de ces fragments puissent correspondre aux amorces choisies pour détecter le Covid-19. Si un des ces fragments était amplifié par PCR, une personne non infectée par le SARS-Cov-2 serait quand même détecté positif au Covid-19.

Alors, M.Véran nous dirait que les signes cliniques permettent ou non de valider cette positivité. Sauf que là encore, les incertitudes sont nombreuses, même si certains dogmes ont été établis pour les nier. En effet, et comme évoqué encore une fois dans l’article sus-cité, le tableau clinique de la Covid-19 peut être similaire en de nombreux points avec d’autres viroses respiratoires. Le Haut conseil de la Santé publique le reconnaît dans ses dernières recommandations.

Le HCSP reconnaît donc que le diagnostic clinique pour distinguer la Covid-19 est incertain. Il affirme cependant que l’anosmie et l’agneusie seraient deux symptômes assez caractéristiques. Cela nous surprend. Cette démarche n’est pas très scientifique, mais il nous a toujours semblé avoir souvent souffert d’anosmie et d’agueusie lors de gros rhumes ou de grosses grippes par le passé. Avoir la crève et ne plus sentir, ni même goûter son café, nous semblait être un grand classique. C’est pourquoi, et nous vous invitons à en faire de même, nous avons consulté les archives Internet quant à la survenue de ces symptômes dans des cas de grippes ou de rhume. Et il se trouve que tous les documents, les plus officiels qui soient, évoquent l’anosmie et l’agueusie comme deux symptômes fréquents des gros rhumes et des grippes. La liste est tellement exhaustive que nous vous incitons à vérifier par vous-même, mais ces extraits nous semblent plutôt éloquents car destinés au grand public, ils démontrent que c’est bien un classique (2) et (3). Il est surprenant que ce soit devenu la marotte des médecins pour distinguer la Covid-19 des autres maladies respiratoires.

Quoi qu’il en soit, il semble très compliqué de se baser sur le tableau clinique pour distinguer la Covid-19 des autres viroses respiratoires saisonnières. C’est pourquoi il est indispensable de croiser ce tableau clinique avec des tests PCR les plus précis qui soient pour minimiser les risques de confusion.

Raoult est un grand infectiologue, Veran se veut grand communicant.

Elle est là toute la différence entre nos deux protagonistes : Raoult a utilisé les tests PCR pour soigner, Veran les a instrumentalisés pour communiquer. Dans le premier cas, les tests PCR sont comme nous l’avons vu et quelles que soient leur limites, indispensables au regard de l’aspect pathognomonique de la Covid-19. Dans le second cas, les tests PCR sont inutiles voire dangereux pour notre démocratie.

L’IHU de Marseille a publié une étude de grande qualité qui traite notamment du bon usage des tests PCR (4). Dans cette publication, on constate que l’usage fait des tests PCR par l’IHU de Marseille atteint une précision qui le transforme en art. Mais surtout démontre, qu’encore une fois, le reste des structures hospitalières françaises devrait s’appuyer sur le travail fait par l’IHU de Marseille et par Didier Raoult plutôt que de le traiter de charlatan.

En effet, l’IHU de Marseille limite le nombre de cycle d’amplification à 35 (Ct cut off) et il y est estimé qu’au-dessus d’un Ct de 33, le patient n’est plus contaminant. Cela correspond d’ailleurs aux mises en garde récentes de la CDC, autorité sanitaire américaine, qui recommande d’être précautionneux avec l’interprétation des tests car l’ARN viral pouvant subsister 3 mois dans les muqueuses respiratoires, le nombre de faux positifs, porteurs du Sars-CoV-2 mais ni malades, ni contaminants, pouvait être très important.

La meilleure manière de minimiser ces faux positifs, outre le fait de corréler le test PCR avec d’autres informations, notamment le tableau clinique, est de prendre un cycle d’amplification qui ne soit pas trop élevé. Habituellement, on estime qu’il ne faut pas tenir compte d’un nombre de cycle d’amplification supérieur à 36, car sinon on amplifie tout et n’importe quoi. Pour les différentes viroses respiratoires, on estime, comme l’IHU de Marseille pour la Covid-19, qu’un cycle d’amplification autour de 35 permet de détecter les patients malades. Et quel que soit la maladie, on estime que le nombre de cycles d’amplifications doit être strictement inférieur à 40 pour pouvoir interpréter les résultats. Dans une publication de l’institut national des systèmes de mesures allemand, il est estimé que : « Un problème commun rencontré avec certaines des techniques publiées est que beaucoup des approches qPCR pour la spéciation de viande tendent à démontrer la réactivité croisée pendant les cycles ultérieurs du PCR. Cela est démontré par de faux positifs qui se produisent lorsqu’un essai d’amorce et de sonde spécifique à une espèce amplifie l’ADN non ciblé d’autres espèces de viande après environ 35 cycles » (5). Au-delà de 35 cycles, les tests PCR ne peuvent distinguer un mouton d’un bœuf. Alors que penser de tests PCR avec des patients diagnostiqués positifs à la Covid-19 (par abus de langage…) avec 40 cycles d’amplification…

C’est là qu’est la supercherie mis en place par les autorités sanitaires internationales. Parfois, un simple détail peut rendre totalement inefficiente la plus puissante des technologie. Ici, ce détail est un trait, un simple trait. En effet, même si comme nous venons de l’exposer un nombre d’amplification supérieur à 35 induit de probables réactions croisées avec d’autres virus, mais surtout implique qu’une part importante des patients diagnostiqués positifs ne soient ni malades, ni contagieux, comme le précise la très bonne revue « Industrie et technologie » (6), la plupart des tests fixent le Ct à… 40, indique le NYT. Certains à 37. « Des tests avec des seuils aussi élevés peuvent ne pas détecter uniquement du virus vivant mais aussi des fragments génétiques, restes de l’infection qui ne posent pas de risque particulier », précise le quotidien. Une virologue de l’Université de Californie interrogée admet qu’un test avec un Ct supérieur à 35 est trop sensible. « Un seuil plus raisonnable serait entre 30 et 35 », ajoute-t-elle. »

Il est déjà évident ici qu’utiliser des tests avec des seuils au-dessus de 35 et jusqu’à 40 cycles ne peut que donner de faux résultats. Mais il est encore surprenant d’apprendre que beaucoup de laboratoires européens et français interprètent ces tests avec un nombre de cycle d’amplification de 40. Ce seuil ne devrait jamais être considéré comme interprétable, et encore moins comme valide, pour détecter un cas positif. Pourtant c’est ce seuil qui est retenu par toutes les autorités sanitaires occidentales : OMS, FDA, CDC, HSA, HCSP, ANSM… On retrouve cette synergie surprenante entre ces différentes instances dans la polémique sur l’hydroxychloroquine, pour le Remdesivir, pour les masques, pour le confinement…  Ce seuil de 40 ne devrait même pas être atteint et nombre de publications expliquent clairement qu’à ce seuil, on détecte tout. D’ailleurs, jusqu’ici, et dans tous les diagnostics PCR, il a toujours été mentionné que ce seuil devait être strictement inférieur à 40 comme indiqué précédemment (<40). Nos autorités sanitaires ont peut-être simplement fait une erreur, laissé une coquille lorsqu’elles ont inclus les seuil égaux à 40 (<=40). Avec des seuils comme ceux-là, les résultats des diagnostics de la Covid-19 sont « au petit bonheur la chance », ce qui explique d’ailleurs le fait que des personnes testées positives le lundi deviendront négatives le mardi.

Lorsque les morts deviennent un outil de communication .

Olivier Véran n’aime pas la contradiction, c’est en train de devenir de notoriété publique. Il a toujours raison, surtout quand il a tort, comme nous avons pu le voir pour les masques, les respirateurs, les tests lors du premier épisode du printemps. Même face au président de la République. Ce dernier avait en effet pensé, à juste titre croyons-nous, que l’épidémie était terminée. Olivier Véran nous assénait à longueur d’ondes que le virus reviendrait, en accord avec les grands laboratoires pharmaceutiques, trop heureux de vendre des masques, des traitements, des tests et des analyse biologiques, et qui ne souhaitaient pas voir se tarir la poule au oeufs d’or. D’où lui venait cette conviction ? Toutes les épidémies suivent habituellement la même courbe en cloche que le professeur Raoult avait maintes fois utilisée pour expliquer qu’il ne pensait pas qu’il y aurait une seconde vague. Cette courbe est connu de tous les épidémiologistes. C’est un modèle robuste qui s’est à chaque fois vérifié. Comment se fait-il alors que notre ministre ait eu cet éclair de clairvoyance ? Il n’a pas brillé depuis le début par son sens de l’anticipation, c’est le moins qu’on puisse dire…

Nous pensons avoir la réponse et elle est en lien avec les tests PCR. Nous sommes conscients de ne pas avoir découvert l’eau chaude avec les problèmes de fiabilité des tests PCR, notamment utilisé avec des seuil de 40. Tous les scientifiques utilisant la PCR savent cela. Donc tous les scientifiques intègres ne pourraient nier que les tests PCR utilisés comme ils le sont en ce moment, sauf selon la « méthode marseillaise », ne sont pas fiables et détectent tout. D’ailleurs, cet été, malgré la disparition de la Covid-19 dans sa forme grave, nous continuions à détecter de nombreux cas positifs. Comme une sorte de bruit de fond. Il y avait les tests positifs, mais pas les symptômes. Aujourd’hui, nous avons les tests positifs et les symptômes. Quels sont ces symptômes ? Des rhumes, avec nez qui coule, qui pourtant n’était pas un symptômes de la première version du Covid-19, des courbatures, parfois de la fièvre, voire de l’anosmie et de l’agueusie. Comme nous l’avons déjà, évoqué, ces symptômes ne sont pas caractéristiques du Covid-19 et de nombreuses viroses respiratoires peuvent les engendrer.

Il était dès lors évident que l’automne venu, ces symptômes allaient se démultiplier. Il était donc facile de prévoir, sachant que les tests présenteraient un grand nombre de faux positifs et que le nombre de personnes qui viendraient se faire tester seraient bien plus important, qu’on aurait un épisode épidémique. Comme nous l’avons démontré, cette épidémie n’est que l’épidémie classique des viroses automnales. Elle était prévisible, il n’y a donc aucune clairvoyance de la part de Mr Véran, ni plus des laboratoires pharmaceutiques. Une manipulation qui s’apparente à du délit d’initier. Tellement facile de parier quand on connaît le résultat en avance.

Réponses aux questions posées sur tests PCR

Voir mail avec les questions en fin d’article

Pour répondre à vos questions :

– Comment peut-on être certain que les amorces sont spécifiques au SARS-COV2 (initial mais aussi lequel à travers tous les pays ?) et surtout par rapport à ses mutations actuelles. J’ai notamment cru comprendre à travers l’ étude en annexe que le test actuel réagissait à d’autres coronavirus ?

Pour savoir si les amorces sont spécifiques au SARS-COV2, c’est à dire si elles ne sont s’hybrider que sur le génome de ce virus et pas sur celui de virus apparentés, on peut tout d’abord faire des alignements de séquences grâce aux bases de données qui référencent l’ensemble des séquences des génomes viraux. On cherche ainsi si la séquence des amorces « matchent » uniquement avec le génome du SARS-CoV2 (et avec tous les variants du SARS-Cov2) ou si elles « matchent » aussi avec d’autres génomes viraux. Cette analyse bio-informatique est une première indication. Ensuite on peut tester directement par l’expérimentation: on réalise la PCR avec les amorces choisies sur différents échantillons : SARS-Cov2, autres virus….et on teste ainsi si les amorces n’amplifient que le SARS-cOV2 ou si elles amplifient d’autres virus. Ce qui est préconisé est de choisir des amorces dans des régions très conservées du SARS-Cov2 (pour que la probabilité d’apparition de mutations dans ces régions soient faibles). Oui certaines amorces utilisées dans certains tests réagissent avec d’autres coronavirus mais dans ce cas, il est fait systématiquement 2 PCR consécutives : une avec des amorces qui peuvent aussi réagir avec d’autres coronavirus et ensuite, si le test est positif, une 2e PCR, elle très spécifique du SARS-Cov2.


-Le choix des amorces a-t-il évolué depuis le début de l’année?

Oui, au tout début de l’épidémie, les différents centres de référence de différentes pays ont publié des protocoles « maison » de RT-qPCR avec chacun leur amorces (protocoles disponibles sur le site de l’OMS). Aujourd’hui, il y a, en France, 96 tests différents de RT-qPCR déclarés sur le site https://covid-19.sante.gouv.fr/tests validés par un marquage CE ou par le CNR. Chaque test avec ses propres amorces. 

– Qui décide du choix de ces amorces ?

– Qui (firme et pays d’origine) fournit ces amorces ?

Ce sont les labos ou entreprises biotech qui développent les tests qui font le « design » de leur propres amorces. Il n’y a donc pas une firme ou un pays qui fournit les amorces. Ensuite le test doit être validé par un marquage CE ou par le CNR pour pouvoir être mis sur le marché

Sont-elles les mêmes dans les différents kits commerciaux au sein d’un pays ou de l’ensemble des pays?

Les amorces sont différentes dans chaque kit commercial différent. C’est même en général ce qui différencie un test d’un autre et qui fera qu’un test sera plus sensible ou plus spécifique qu’un autre.

– Quelles sont les procédures de contrôle officielles garantissant que les tests sont faits correctement (notamment avec les tests et calibrages des écouvillons et des équipements de test permettant d’éviter des faux négatifs et faux positifs, avec le respects des procédures sanitaires et types de laboratoires,…) ?

En ce qui concerne l’amplification PCR en elle-même, des contrôles positifs et négatifs sont inclus pour vérifier la qualité de la manipulation. Le prélèvement est un autre problème. La mauvaise réalisation de l’écouvillonnage sera bien sûr un facteur faussant le résultat final.

Cordialement,

Clémence Richetta

——– Message d’origine ——–
Le 21 oct. 2020 à 11:54, alain.flamion < alain.flamion@protonmail.com > a écrit :

Bonjour,

Suite à votre excellente vidéo sur le fonctionnement des tests de dépistage Covid, il y a quelques questions que je me pose et je me permets de vous les adresser.
– Comment peut-on être certain que les amorces sont spécifiques au SARS-COV2 (initial mais aussi lequel à travers tous les pays ?) et surtout par rapport à ses mutations actuelles. J’ai notamment cru comprendre à travers l’ étude en annexe que le test actuel réagissait à d’autres coronavirus ? 
– Le choix des amorces a-t-il évolué depuis le début de l’année?
– Qui décide du choix de ces amorces ?
– Qui (firme et pays d’origine) fournit ces amorces ?
– Sont-elles les mêmes dans les différents kits commerciaux au sein d’un pays ou de l’ensemble des pays?
– Quelles sont les procédures de contrôle officielles garantissant que les tests sont faits correctement (notamment avec les tests et calibrages des écouvillons et des équipements de test permettant d’éviter des faux négatifs et faux positifs, avec le respects des procédures sanitaires et types de laboratoires,…) ?

J’apprécierais beaucoup d’être éclairé sur ces questions par vous et je vous en remercie sincèrement d’avance.

Alain Flamion

Un autre montage vidéo d’Eric Remacle sur les tests PCR

Une épidémie de faux tests ?

Extraits d’un long article de France Soir intitulé « Et si la deuxième vague n’était que la houle des viroses respiratoires saisonnières ?« , très documenté sur l’état de fiabilité de l’interprétation des tests RT-PCR. Si on ne fait pas l’effort d’entrer un peu dans cette technicité, on se laisse manipuler par des charlatans qui en font leur veau d’or.

EXTRAITS:

. . . Cela est d’autant plus évident que l’utilité des tests RT-PCR, du moins comme arme principale pour prendre des décisions, interroge de plus en plus le monde médical. En effet, ces tests diagnostic posent plusieurs problèmes et notamment des problèmes de fiabilité. 

C’est ainsi que le Center for Disease Control and Prevention, l’équivalent de notre autorité sanitaire en France, a publié de nouvelles recommandations pour la durée de l’isolement et précautions pour les adultes atteints de COVID-19 ce 19 octobre 2020. On y apprend qu’il ne faut plus baser ses décisions dans la gestion de l’épidémie sur les tests PCR et donc sur les taux de contamination, car la précision de ces derniers ne permet pas d’être sûr que la positivité au test corresponde effectivement à une contamination récente car l’ARN viral peut demeurer 3 mois au moins dans l’organisme. Pis, une grande partie des positifs ne seraient plus du tout contaminants puisque pour les asymptomatiques et les formes modérées, la capacité de réplication du virus et donc sa contagiosité ne dure que 10 jours, et n’est que de 20 jours pour les formes graves et les immunodéficients (2). 

. . .  

Hormis le nombre de tests et donc de détection des cas positifs bien plus importants qui ne peut expliquer à lui seul cet écart considérable même quand on considère les estimations du nombre réels de contaminations en avril, il y a le rôle joué par les tests PCR. Ces derniers ont été conçus pour obtenir une très forte sensibilité, ce qui permet de détecter le moindre fragment de virus surtout au regard du degré d’amplification qui a été décidé. C’est l’inconvénient d’avoir des tests trop sensibles, il repère tout, même des fragments d’ARN viral inerte, sans aucun potentiel infectieux. C’est bien de cela dont il s’agit dans les recommandations du CDC : les tests diagnostic donnent et donneront lieu à une très grande majorité de faux positifsde porteurs du virus qui ne sont ni malades, ni contaminants, pour la simple raison que les personnes testées positives seront pour une grande majorité d’entre elle asymptomatiques et qu’il y a de grandes chances qu’une part de ces asymptomatiques aient même contracté le virus il y a plusieurs semaines. Car, comme le mentionne très bien le CDC, des fragments d’ARN viral subsistent jusqu’à trois mois au moins dans l’organisme. Vous pouvez par exemple avoir contracté le virus au moins de juillet ou au mois d’août, lorsque celui-ci ne causait alors plus trop de dégâts, et être aujourd’hui testé positif. 

Cela suffit à comprendre pourquoi le CDC recommande de ne plus baser sa prise de décision sur les tests RT-PCR. C’est l’inverse de ce qui est proposé par le ministre Véran et ceux qui nous gouvernent, qui bille en tête, ont eu la fulgurante idée de noyer les laboratoires sous les tests PCR pour le Covid-19. Lumineuse idée qui, outre le fait d’empêcher à l’instar des réanimations, de prendre en charge de nombreuses maladies pourtant plus létales, rallonge les délais pour obtenir les résultats des tests, qui en deviennent pour le coup encore plus inutiles. A tel point que le coût de ces tests qui s’élèvent déjà à plusieurs centaines de millions d’euros et dépassera à n’en pas douter plusieurs milliards, pourrait mettre en péril la santé financière de la sécurité sociale. Il est alors intéressant de consulter la notice des différents tests : pour tous, il a toujours été mentionné que le résultat du test devait toujours être interprété à l’orée de l’analyse clinique. Il était donc inutile dès le départ, et bien avant que la CDC en vienne à ces conclusions, de démultiplier les tests notamment pour les asymptomatiques. Pis, cette frénésie de tests voulue par notre ministre chamboule tout, aura annihilé le peu d’utilité que l’on aurait pu avoir de ces tests.

A la pêche aux houles, houles, houles 

Il faut alors bien comprendre comment fonctionnent ces tests RT-PCR.
Il s’agit de fabriquer des amorces que nous pouvons considérer comme des hameçons. Nous en utilisions un seul au printemps, mais depuis les tests PCR multiplex se sont démocratisés et nous utilisons maintenant deux à trois amorces, c’est ce que l’on appelle le multiplex. Cela revient donc à avoir trois hameçons sur sa canne à pêche. Ce qu’il faut savoir, c’est que ces hameçons sont particuliers : ils sont censés être spécifiques à des régions du poisson, le Covid-19 et ne sont censés reconnaître que ces régions présentes sur le Covid-19. En terme plus classique, ces amorces sont spécifiques de séquences de nucléotides exclusives du Covid-19. 

Le problème avec ces hameçons, c’est que même s’ils étaient ultra spécifiques au Covid-19, ils ne peuvent distinguer les poissons vivants des poissons morts. Or dans la mare très riche que forment nos muqueuses nasales et pulmonaires, il y a énormément de poissons morts pour une personne qui a contracté le virus même trois mois avant. Il y a donc de fortes chances d’attraper un poisson mort chez de nombreuses personnes comme le CDC le signale. 

Vous pouvez observer ci-dessus l’ARN du virus où sont localisées les gènes dont on se sert pour fabriquer les amorces qui permettent de déceler sa présence. On se sert de logiciels puissants pour trouver des séquences spécifiques à ce virus et à aucun autre. Comme pour la prise de décision qui repose sur de gros ordinateurs qui projettent l’hécatombe qui vient en reposant leurs calculs sur l’accélération du taux de contaminations, là encore, on s’en remet à des processeurs, à de l’intelligence artificielle qui est au cerveau humain ce que la neige artificielle est au flocon. Car bien évidemment, ce modèle est un modèle théorique, qui même s’il a été testé en laboratoire, in vitro, n’en demeure pas moins théorique. C’est un peu comme pour les tests PCR ou la conception du Remdesivir, ce médicament miracle qui ne soigne rien : on a fait passer l’outil avant l’idée, on a confié nos responsabilités à des jouets technologiques plutôt que de mettre ces jouets au service de nos responsabilités. Cette recherche d’amorce permet le séquençage des génomes viraux et le croisement de milliers de souches de virus différents est indéniablement un bel outil, un outil révolutionnaire. Mais à la manière des tests, il ne remplacera jamais une analyse humaine, une analyse clinique, inférentielle qu’aucune de vos consoles de jeux ne parviendra à effectuer. Jamais, je l’espère, au regard du pouvoir déjà bien trop important que vous offrez à ces innovations technologiques.  

L’ARN d’un virus est une molécule fragile. C’est d’ailleurs cela qui explique le nombre de mutations très important malgré la petitesse des fragments en question. Sans rentrer dans le détail, il suffit de comprendre que les modèles informatiques qui projettent un « lien » entre les amorces des tests PCR et l’ARN viral est purement hypothétique et que les conditions in vivo induisent que la variété des fragments ARN présents dans les muqueuses respiratoires qui pourraient effectivement correspondre aux amorces des tests est considérable : fragments d’ARN humain, fragments d’ARN de tous types de virus ou de bactéries mortes, fragments d’ARN de SARS-Cov-2 morts. Une récente publication explique même que « de façon inattendue, les données obtenues montrent qu’en plus des espèces d’ARN « matures », le plasma humain contient une proportion importante de fragments d’ARN « dégradés » et que « une proportion substantielle d’exARN d’origine non humaine, proviennent de la peau humaine et du microbiote intestinal, y compris le microbiote viral. Ces exARN exogènes représentent jusqu’à 75-80% de l’ARN total contenu dans les vésicules extracellulaires hautement purifiées » (3). Or comme nous l’avons déjà expliqué, l’ARN est une molécule fragile et encore plus lorsqu’elle est sous forme dégradée dans le milieu extracellulaire. La probabilité d’avoir un nombre incalculable d’ARN dégradé et recombiné est très forte. D’ailleurs ce nouvel univers des ARN extracellulaires et notamment ceux contenus dans les vésicules majoritairement d’origine microbienne font de l’objet de recherches très intense depuis quelques années pour leur potentiel rôle de biomarqueurs de maladie chronique comme le cancer. Mais les scientifiques se heurtent au même obstacles que nos élites sanitaires qui font reposer leurs décisions sur des tests RT-PCR, à la différence qu’eux en ont conscience : il est très compliqué de purifier l’ARN extracellulaire vésiculaire et il y a un consensus à adopter d’après la Société internationale des vésicules extracellulaires, « nos connaissances incomplètes de la nature des ARN extracellulaires vésiculaires et de la façon de les étudier efficacement et de manière fiable, interdit actuellement la mise en œuvre de normes d’or dans la recherche de cet ARN » (4). En somme, nous ne savons rien de la diversité des ARN contenus dans les fluides humains et donc dans les muqueuses des voies respiratoires.  

Or cet aveu d’ignorance est tout aussi vrai pour l’ARN du SARS-Cov-2 : celui-ci n’a jamais été purifié à partir des fluides extracorporels humains. Comme le spécialiste australien des maladies infectieuses Sanjaya Senanayake, l’a déclaré dans une interview à la télévision « ABC TV » en réponse à la question : Quelle est la précision du test COVID-19 ? »  

« Si nous avions un nouveau test pour détecter le staphylocoque doré dans le sang, nous avons déjà des hémocultures, c’est notre étalon-or que nous utilisons depuis des décennies, et nous pourrions comparer ce nouveau test à cela. Mais pour COVID-19, nous n’avons pas de test de référence. »

Cela signifie que les tests PCR même multiplex qui nous servent de diagnostic actuellement et sur lesquels se fondent les arguments et les prises de décisions de nos autorités sanitaires ne se basent que sur le séquençage du génome du virus et sur les essais in vitro donc sur un modèle purement spéculatif qui ne tient pas compte des multitudes interactions que subit l’ARN viral dans notre organisme et surtout, de la variété incommensurable des fragments d’ARN présents dans nos muqueuses respiratoires. Le Dr Charles Calisher, virologue chevronné, a reconnu lors d’une interview « qu’aucune publication à ce jour ne travaillait sur un virus SARS-Cov-2 isolé et purifié. » Cela reviendrait à dire qu’en fait qu’on ne peut pas conclure que les séquences génétiques d’ARN, que les scientifiques ont prélevées dans les échantillons de tissus préparés dans les essais in vitro mentionnés et pour lesquelles les tests PCR sont finalement « calibrés », appartiennent à un virus spécifique – dans ce cas SRAS-CoV-2

Même le professeur Chen Wang, vice-président de l’Académie chinoise d’ingénierie et président de l’Académie chinoise des sciences médicales et président du Peking Union Medical College, a admis en février 2020 que les tests PCR n’étaient « précis qu’à 30 à 50% ». Le Dr Sin Hang Lee du Milford Molecular Diagnostics Laboratory a envoyé une lettre à l’équipe de lutte contre les coronavirus de l’Organisation Mondiale de la Santé et à Anthony S. Fauci, conseiller auprès du président des Etats-Unis quant à la Santé Publique, le 22 mars 2020, disant que : « Il a été largement rapporté dans de sérieux médias sociaux que les kits de test RT-qPCR [Reverse Transcriptase quantitative PCR] utilisés pour détecter l’ARN du SARSCoV-2 dans les échantillons humains génèrent de nombreux faux positifs et ne sont pas assez sensibles pour détecter certains cas réels positifs. »

Et cela est d’autant plus évident quand on sait que des fragments d’ARN viral du SARS-Cov-2 mais aussi de tous les virus respiratoires pouvant provoquer des infections respiratoires aiguë et qui sont très variés (adénovirus, rhinovirus, entérovirus, influenza…) peuvent rester 3 mois dans les muqueuses des voies respiratoires. Alors que dire des multiples recombinaisons possibles de ces fragments d’ARN soumis à l’environnement très réactif de nos muqueuses. En considérant toujours ces tests RT-PCR comme des cannes à pêche munies de plusieurs hameçons, c’est comme si des hameçons spécialisés pour la pêche à la carpe capturaient de la perche, du brochet, du goujon, de la truite, du silure et même des algues. 

De faux tests peuvent donner lieu à de fausses épidémies 

Il y a une jurisprudence, qui démontre mieux qu’on ne pourrait le faire qu’il y a de fortes chances que cette nouvelle vague tant annoncée par nos autorités sanitaires et de nombreux médecins trop désireux d’avoir eu raison d’être alarmistes ; cela permet aussi de dénoncer les « rassuristes ».  

En effet, une fausse épidémie a déjà été montée de toutes pièces en se basant sur ces fameux tests RT-PCR. Il s’agit d’une épidémie de coqueluche survenue dans le New Hampshire aux Etats-Unis en 200,6 (5). Des milliers de personnes travaillant dans le centre hospitalier de Dartmouth ont été testées par test PCR et ont été vaccinés puis traités aux antibiotiques pour que l’on finisse par découvrir huit mois plus tard qu’aucune de ces personnes n’avait contracté la coqueluche. Un cas similaire est intervenu à l’hôpital pour enfants de Boston avec toujours une épidémie de coqueluche révélée par des PCR. Les cultures en laboratoire, là encore, ne révèleront plus tard qu’aucun des enfants n’avait contracté la coqueluche. On parle pourtant ici de bactéries et de la molécule d’ADN bien plus robuste que l’ARN…Ces deux cas d’écoles interrogent sur l’opportunité d’utiliser à nouveau la culture des pathogènes suspectés pour s’assurer du diagnostic précoce. 

Dans notre cas, la supposée deuxième vague de l’épidémie de Covid-19, plusieurs publications interrogent justement la spécificité des tests RT-PCR utilisés pour diagnostiquer la maladie. En effet, une publication récente, qui n’a pas vocation à dénoncer ces tests, ni même à remettre en cause la reprise de l’épidémie, propose innocemment d’inclure une nouvelle amorce dans les tests PCR car d’après les auteurs :  

« L’OMS recommande des gènes RdRP, E et N pour la détection du coronavirus (Corman et al., 2020a) : dépistage par gène E pour la première ligne, gène RdRp pour l’essai de confirmation et gène N pour un test confirmatoire supplémentaire. Bien que ces gènes aient été signalés comme cibles potentielles pour la détection du coronavirus, nous avons découvert qu’un seul d’entre eux (RdRP_SARSr-P2) était presque spécifique pour le nouveau coronavirus et que les autres sondes introduites détecteraient les autres types de coronavirus. À cet égard, les résultats des tests faussement positifs peuvent s’étendre pour la Covid-19, et de nombreux patients présentant peuvent être infectés par les autres types de coronavirus » (6). D’après cette équipe de chercheurs et leur publication validée et soumise à un comité de lecture, le test RT-PCR le plus élaboré, le multiplex, qui s’appuie sur 3 amorces, pourrait générer des tests positifs Covid-19 alors qu’il s’agirait d’autres coronavirus, dont les souches sont très nombreuses.Mais il y a plus encore, les auteurs expliquent que deux des trois amorces ne sont que très peu spécifiques et que la troisième peut aussi induire des réactions croisées avec d’autre coronavirus. Or les laboratoires biologiques valident la positivité des tests Covid-19 même lorsqu’une seule des trois amorces est positive. Il est donc indéniable que les personnes testées positives sont probablement porteuses de nombreux coronavirus que le SARS-Cov-2, ainsi que comme on peut le penser de d’autres virus saisonniers. Ci-dessous, vous pouvez apprécier le protocole de test d’un des plus grands laboratoires d’analyse biologique français : 

Donc, outre toutes les remarques faites précédemment sur la diversité des fragments d’ARN présents dans nos muqueuses respiratoires et le fait que même les fragments réels d’ARN du SARS-Cov-2 ne nous renseignait en rien sur la capacité de réplication de ces ARN viraux donc sur la contagiosité des porteurs, on apprend que les tests diagnostiques ne sont pas spécifiques du SARS-cov-2 et peuvent détecter d’autre coronavirus, ainsi que, d’après nous, des adénovirus, des entérovirus et des rhinovirus. 

En d’autres temps, nous serions en pleine épidémie de rhinovirus et les urgences devraient être saturées comme chaque année par l’arrivée massive de malades souffrant de viroses respiratoires aiguës : bronchiolites, rhinites, pneumopathies virales, virus syncitial. Car toutes les années, à la même époque, c’est-à-dire quelques semaines après la rentrée des classes, les services hospitaliers sont plus que saturés.

Or, depuis l’arrivée du Covid-19, c’est comme si toutes les autres pathologies virales respiratoires avaient disparu. La grippe et ses différentes souches avec à peine une centaine de cas pour 2020 comparativement aux milliers de cas annuels habituellement observés, semble être partie en vacances, les rhinovirus, adénovirus, entérovirus semblent s’être confinés en présence de la Covid-19. On estime que les viroses respiratoires, toutes confondues, sont responsables de 8 % des décès chaque année. Cela signifie qu’en prenant la fourchette la plus basse de mortalité, on estime à quelque 44 000 décès pour viroses respiratoires aiguës mais les chiffres bruts démontrent que l’on est bien en-deçà du chiffre réel. 

Afin de ne pas induire des discussions interminables sur les chiffres, nous prendrons la fourchette basse, à savoir 44 000 décès pour infections virales aiguës des voies respiratoires. Actuellement sur les décès dus à la Covid-19, nous nous approchons des 35 000 décès alors que nous sommes bientôt au mois de novembre et donc à la fin de l’année. Or si l’on considère que la grippe, principale cause de mortalité dans cette catégorie de décès, les viroses respiratoires, ne provoquera cette année tout au plus quelques centaines de décès, on peut penser que le nombre de décès suite à une infection virale aiguë des voies respiratoires n’excédera pas le chiffre moyen des décès annuels pour cette même cause, à savoir 44 000, en incluant les décès dus au Covid-19. C’est d’ailleurs pour cela que malgré la pandémie de Covid-19 et le nombre important de décès au printemps, nous n’observons qu’une surmortalité très faible (6 à 9%) due à la Covid-19, par rapport aux années 2018 et 2019. 

Alors, bien sûr nos « élites alarmistes », expliqueront que ce qu’elles observent dans les hôpitaux ne prête pas à discussion. Sauf que là encore, cela n’est que de la communication. Aucun de ces médecins, chercheurs ou carriériste politique ne peut affirmer que la situation actuelle est due au Covid-19 et encore moins que la saturation des hôpitaux actuelle est plus importante cette année que les autres, à moins d’admettre que l’épidémie de Covid-19 a fait partir en vacances tous les autres virus responsables d’infections virales respiratoires aiguës. Sur quoi se baseraient-ils d’ailleurs pour démontrer que c’est bien la Covid-19 qui génère cet afflux de patients à l’hôpital ? Sur les tests PCR ? Nous avons établi qu’ils ne permettaient pas de distinguer sérieusement l’étiologie de l’infection respiratoire responsable des hospitalisations, des admissions en réanimation et mêmes des décès. Sur l’analyse clinique ? Là encore, nous sommes au regret de leur apprendre, et même la HCSP s’en émeut, que la distinction clinique entre les infections causées par les virus de la grippe ou d’autres virus respiratoires n’était pas aisée pour ne pas dire quasi impossible tant la symptomatologie est semblable entre ces différentes atteintes (7). En effet, dans son avis relatif à la préparation des épidémies de virus hivernaux en période de circulation du SARS-CoV-2 du 17 septembre 2020, la HCSP affirme clairement que « les éléments strictement cliniques ne permettent pas d’éliminer formellement un diagnostic de Covid-19, particulièrement chez les personnes âgées. » 

Pis, la haute autorité sanitaire reconnaît que « chez l’adulte comme chez l’enfant, toutes les pathologies virales saisonnières respiratoires ou digestives peuvent donner des signes compatibles avec un Covid-19 ». 

Mieux, la HCSP écrit : « S’il existe des signes cliniques hautement évocateurs du Covid-19 (anosmie ou agueusie, cf.infra), aucun n’est toutefois pathognomonique de cette infection. En outre, de nombreux signes cliniques sont communs aux infections par les virus respiratoires, en particulier à la grippe et au Covid-19 ».

A moins de traiter de complotiste, le CDC autorité sanitaire américaine qui remet en cause la précision des tests PCR, ainsi que la HCSP, autorité sanitaire française qui dit clairement que les signes cliniques ne sont pas pathognomoniques de la Covid-19, nos alarmistes n’ont plus guère d’arguments pour affirmer de manière péremptoire comme ils le font que nous sommes devant une nouvelle vague de Covid-19. 

Quoi qu’il en soit, en science, lorsque l’on est confronté à plusieurs hypothèses, on choisit la plus simple. Ici, deux hypothèses sont plausibles au regard des éléments que nous venons de présenter et des chiffres de la mortalité : soit il y a un amalgame de toutes les viroses respiratoires aigües qui chaque année font imploser nos hôpitaux, soit les autres pathologies virales ont disparu, sont parties en vacances ou se sont confinées en présence du SARS-Cov-2. A vous de choisir, quelle hypothèse est la plus simple et la plus plausible. Pour le docteur Bensadoun, médecin consultant pour Cnews, qui n’a rien d’un complotiste, ni d’un « rassuriste », dit clairement cela : Dans mon cabinet, toutes les rhino-pharyngites que j’aurais étiquetées « rhino-pharyngites » les années précédentes je les étiquette « Covid ». A bon entendeur. 

En conclusion, le collectif citoyen et l’association « Bon sens » avec laquelle nous travaillons, demandent au Président de la république d’exiger une analyse plus sérieuse et plus précise de la situation épidémiologique en France avant de s’engager dans un contresens et de prendre des décisions dont les conséquences seront assurément bien plus funestes que la Covid-19. A cet effet, il semble indispensable de mettre en place d’autres éléments diagnostics permettant de minimiser les risques de confusion entre la Covid-19 et les autres infections virales respiratoires saisonnières. Aussi, dans un souci de transparence et d’apaisement du sentiment anxiogène délétère qui s’empare de nombre de nos concitoyens, nous demandons aux autorités sanitaires de fournir des données plus précises, incluant entre autres la place des autres pathologies, notamment respiratoires, dans la saturation habituelle des services hospitaliers. 

Ceci sont des extraits de l’article plus complet et plus long de France Soir.

Merci à France Soir pour ses articles et analyses indépendantes et très fouillées.

N’hésitez pas à soutenir France Soir (dès 1€/mois).

Il existe un meilleur test que le PCR pour contrôler l’épidémie

Pour contrôler l’épidémie il vaut mieux un test moins sensible, moins coûteux mais utilisable par chaque personne avec résultat immédiat. Cela permettrait à chacun de pouvoir agir en responsabilité par rapport à sa contagiosité. Cette vidéo de Stéphane Guay vous l’explique comme toujours avec beaucoup de pédagogie.

La fausse seconde vague créée de toute pièce par les tests RT PCR

Interview du médecin réanimateur en soins intensifs belge Pascal Sacré, sur ses interrogations pleines de bons sens sur l’adéquation du test PCR pour détecter cette « maladie » et le manque de transparence de cette politique. Il y a aborde également sa vision sur le nombre d’hospitalisations actuel.
En se soumettant aux tests PCR avec docilité, la population maintient sans le savoir la propagande de terreur (non basée sur les faits) des gouvernements ainsi que l’état de  » transe hypnotique  » induit par les mesures autoritaires liées à la crise  » sanitaire « .

Nous vous recommandons de lire l’article très complet et intéressant que Pascal Sacré à écrit sur ce sujet :  » PCR ou comment enfumer toute l’humanité  »

Scandaleux, suite à cette vidéo, Pascal Sacré a été licencié de l’hôpital de Charleroi.

Ancienne interview de Kary Mullis, prix Nobel et inventeur du procédé PCR

Dans cet interview d’il y a quelques années (parce qu’il est décédé en 2019), Kary Mullis déclare que l’interprétation des tests ne permet pas de savoir si on est malade. Il en parlait à propos du virus du VIH et le raisonnement est le même pour le SRAS COV2.