COVID19 – Preuve d’une fraude mondiale !

Lien vers l’article original du site avec tous les liens

Iain Davis

Le COVID 19 et les réponses gouvernementales ultérieures semblent faire partie d’un complot international en vue de commettre une fraude. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID 19.

Parfois, vous devez suivre votre instinct. Je ne suis pas un expert en génétique et, comme toujours, je dois être corrigé. Cependant, mon attention a été attirée sur certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur  conseil consultatif, composé  de médecins et de scientifiques éminemment qualifiés, confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction en anglais (voir le précédent article de avec la traduction en français )  de leur rapport et je  peux corroborer l’exactitude de leurs affirmations concernant les séquences nucléotidiques répertoriées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire la même chose.

D-Salud-Discovery indique qu’il n’y a pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du COVID 19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de COVID 19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de celui-ci.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve d’une pandémie, simplement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, autre que les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette  «classe de parasites»  a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’enquêtes et de poursuites devant un tribunal.


L’Organisation mondiale de la santé (OMS) a  classé le COVID-19  (COronaVIrus Disease 2019). Ils ont déclaré une pandémie mondiale de COVID 19 le 11 mars 2019.

Les directives de l’OMS sur les  analyses de laboratoire  stipulent:

L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau bêtacoronavirus, (dans la même famille que le SRAS-CoV et le MERS-CoV) via le séquençage de nouvelle génération (NGS) à partir du virus de culture ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus SRAS-CoV-2  provoque la maladie COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de situation 1 sur le nouveau coronavirus 2019-nCov de l’OMS  , ils déclarent:

Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 …… Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays l’utilisent dans le développement de kits de diagnostic spécifiques.

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour étude), puis des séquences génétiques ont été  identifiées à  partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été développés et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et des chercheurs chinois, ces tests permettront de trouver le virus responsable du COVID 19.

Pourtant, l’OMS déclare également:

Travaillant directement à partir des informations de séquence, l’équipe a développé une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des  «informations de séquence»  car il n’y avait pas d’échantillon isolé et purifié du virus dit SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines hérissée contenant l’ARN viral).

Cependant, ces structures protéiques ne sont  pas uniques . Ils ressemblent à d’autres vésicules rondes, telles que les vésicules endocytaires et les exosomes.

Les virologues affirment qu’il n’est pas possible d ‘  «isoler»  un virus car ils ne se répliquent qu’à l’intérieur des cellules hôtes. Ils ajoutent que  les postulats de Koch  ne s’appliquent pas parce qu’ils concernent des bactéries (qui sont des organismes vivants). Au lieu de cela, les virologues observent les effets cytopathogènes (CPE) du virus, provoquant la mutation et la dégradation des cellules, dans les cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé pour  la première fois le génome complet du SRAS-CoV-2, ils ont observé le CPE dans les cellules Vero E6 et Huh7. Vero E6 est une lignée cellulaire de singe immortalisée et Huh7 sont des cellules cancéreuses immortalisées (tumorigènes). Cela signifie qu’ils ont été maintenus in vitro (dans des cultures de boîtes de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 est l’idée qu’il s’agit d’un virus zoonotique, capable de combler le fossé des espèces entre les animaux et les humains. Lorsque des  scientifiques du CDC américain ont  «infecté»  diverses cellules avec le nouveau virus, ils ont noté ce qui suit:

Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires de primates et humaines communes, y compris les cellules d’adénocarcinome humain (A549) [cellules pulmonaires], les cellules hépatiques humaines (HUH7.0) et les cellules rénales embryonnaires humaines ( HEK-293T), en plus de Vero E6 et Vero CCL81 [cellules de singe]… Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero [cellules de singe]… Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et Les cellules A549 [cellules du tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2. »

Le CDC n’a observé aucun CPE dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, suggérant qu’une infection d’un humain à l’autre serait impossible.

Notant ce problème, une équipe de scientifiques polonais a introduit ce «virus» séquencé   dans  les cellules de l’épithélium humain (voies respiratoires) . Ils ont observé les effets sur ces cultures d’AOH pendant 5 jours. Ils ont noté une réplication beaucoup plus grande que les scientifiques du CDC, mais ont finalement déclaré:

«Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’AOH.»

Cela signifie qu’ils n’ont vu aucune preuve des virions supposés rompant la membrane de la paroi cellulaire. Encore une fois, suggérant que ce soi-disant virus n’est pas infectieux chez l’homme.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer des maladies. Cela peut même ne pas exister physiquement. N’est-ce rien d’autre qu’un concept basé sur   des séquences génétiques prédictives ?


Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2  (MN908947.1). Cela a été mis à jour plusieurs fois. Cependant, MN908947.1 était la première séquence génétique décrivant l’ agent étiologique présumé du COVID 19   (SARS-CoV-2).

Toutes les déclarations, tests, traitements, statistiques, développement de vaccins et politiques qui en résultent sont basés sur cette séquence. Si les tests pour ce  nouveau  virus n’identifient rien de capable de provoquer des maladies chez les êtres humains, tout le récit du COVID 19 n’est rien d’autre qu’une mascarade.

Les  chercheurs de WUHAN ont déclaré  qu’ils avaient effectivement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques, découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé un  assemblage de novo  et une PCR ciblée et ont trouvé 29 891 paires de bases partageant une correspondance de séquence de 79,6% avec le SARS-CoV.

Ils ont dû utiliser l’  assemblage de novo  parce qu’ils n’avaient aucune  connaissance a  priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle des chercheurs chinois ont  isolé  le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome du coronavirus du SRAS publié (SARS-CoV). Malheureusement, la précision du génome original du SRAS-CoV n’est pas non plus claire.

En 2003, une équipe de  chercheurs de Hong Kong a  étudié 50 patients atteints du syndrome respiratoire aigu sévère (SRAS). Ils ont prélevé des échantillons de 2 de ces patients et ont développé une culture dans des cellules hépatiques de singe foetal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques  «d’origine inconnue».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il appartenait à la famille des Coronaviridae. Considérant que ces séquences suggéraient un virus SARS-CoV nouvellement découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré:

Les amorces de détection du nouveau virus ont été conçues pour la détection par RT-PCR de ce génome de coronavirus humain associé à la pneumonie dans des échantillons cliniques. Sur les 44 échantillons de nasopharynx disponibles auprès des 50 patients atteints du SRAS, 22 présentaient des preuves d’ARN de coronavirus humain associé à la pneumonie.

La moitié des patients testés, qui présentaient tous les mêmes symptômes, ont été testés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce  nouveau  virus SRAS-CoV. La question n’a pas été posée.

Ce virus supposé n’avait qu’une correspondance de séquence de 57% avec le coronavirus prétendument connu. Les 43% restants étaient simplement  «là».  Les données séquencées ont été produites et enregistrées en tant que nouveau génome sous le numéro d’ accès GenBank  AY274119 .

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement renommée SARS-CoV-2). Personne, à aucun stade de ce processus, n’avait produit d’échantillon isolé et purifié de quelque virus que ce soit. Tout ce qu’ils avaient était des correspondances de séquence de pourcentage avec d’autres correspondances de séquence de pourcentage.


Les scientifiques sont très ennuyés car ils n’arrêtent pas de dire que le virus a été isolé mais personne ne les croit. C’est parce que, pour l’instant, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images de virions du SRAS-C0V-2 de confirmer qu’il s’agissait d’images d’un virus isolé et purifié. Aucun d’eux ne le pouvait .

En Australie, des scientifiques du  Doherty Institute ont annoncé avoir  isolé  le virus SARS-CoV-2 . Lorsqu’on leur a demandé de clarifier les choses, les scientifiques ont déclaré:

«Nous avons des séquences courtes (ARN) du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic»

Cela explique pourquoi le  gouvernement australien  déclare:

La fiabilité des tests COVID-19 est incertaine en raison de la base de preuves limitée… Il existe des preuves limitées disponibles pour évaluer l’exactitude et l’utilité clinique des tests COVID-19 disponibles.

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a  écrit une lettre  au Premier ministre britannique Boris Johnson dans laquelle ils lui ont demandé de:

Produire des preuves scientifiques examinées par des pairs de manière indépendante prouvant que le virus Covid-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a  adressé une demande d’accès à l’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. À quoi  ils ont répondu :

PHE peut confirmer qu’il ne contient pas d’informations de la manière suggérée par votre demande. « 

La chercheuse canadienne Christine Massey a fait une demande similaire d’accès à l’information, demandant la même chose au gouvernement canadien. À quoi le  gouvernement canadien a répondu :

Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu localiser aucun document répondant à votre demande. »

Aux États-Unis, le panneau de diagnostic RT-PCR du Center for Disease Control (CDC)   indique:

… Aucun isolat viral quantifié du 2019-nCoV n’est actuellement disponible …… .. La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent causal des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur de tout patient déclaré atteint de la maladie du COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou provoque le COVID 19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Voir aussi: Dr. Tom Cowan w/ Jon Rappoport: SARS-CoV-2 Has Never Been Isolated, Is Only an Imaginary or Theoretical Virus, and, Therefore, No Test Can Detect It


L’OMS, et chaque gouvernement, groupe de réflexion, comité directeur des politiques, conseiller scientifique du gouvernement, institutions supranationales et autres qui promeuvent le récit officiel du COVID 19, affirment que le SRAS-CoV-2 cause le COVID 19.

Bien que personne n’ait jamais produit un échantillon de ce supposé virus, le génome présumé du SRAS-CoV-2  a été publié . C’est dans le domaine public.

On dit que les séquences génétiques clés  du génome du SRAS-CoV-2 ont des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour  identifier  la présence du  «virus» . 

  • Ceux-ci incluent:
    • Gène ARN-polymérase (Rd-Rp) – Cela permet à l’ARN du SARS-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales atteintes de COVID 19.
    • Gène S (Orf2) – cette glycoprotéine forme le pic sur la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 sur les cellules, permettant à l’ARN à l’intérieur de l’enveloppe de la protéine du virion (capside) de passer dans la  cellule maintenant  infectée .
    • Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage viral
    • Gène N (Orf9a) – le gène de la nucléocapside qui lie l’ARN dans la formation de la capside

L’OMS tient un  registre accessible au public  des amorces et sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences nucléotidiques spécifiques qui se lient (s’hybrident) aux brins antisens et sens de l’ADNc synthétisé (appelées respectivement amorces sens et inverse).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences nucléotidiques appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Lors de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, la sonde se désintègre en libérant un fluorescent ou un colorant qui peut ensuite être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

L’ outil de recherche d’alignement local de base  (BLAST) est un autre élément accessible au public  . Cela permet à quiconque de comparer les séquences nucléotidiques publiées avec toutes celles stockées par la base de données génétique des National Institutes of Health (NIH) des États-Unis appelée GenBank. Par conséquent, nous pouvons BLASTER les amorces, sondes et séquences de gènes cibles du SRAS-CoV-2 revendiquées.

Les protocoles d’amorces et de sondes sens et inverses de l’OMS pour le génome viral présumé du SRAS-CoV-2 sont basés sur les profils de gènes RdRp, Orf1, N et E. N’importe qui peut les exécuter via BLAST pour voir ce que nous trouvons.

La séquence nucléotidique vitale RdRP, utilisée comme amorce sens est – ATGAGCTTAGTCCTGTTG. Si nous exécutons un nucléotide BLAST, celui-ci est enregistré comme un isolat  complet de SARS-CoV-2  avec une identité de séquence à 100%. De même, la séquence d’amorce du gène E inverse – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui  identifie également  SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences nucléotidiques des génomes microbiens et humains. Si nous recherchons la séquence RdRp SARS-CoV-2, elle révèle 99 chromosomes humains avec une correspondance d’identité de séquence à 100%. L’Orf1ab (gène E) renvoie 90 avec une correspondance d’identité de séquence de 100% avec les chromosomes humains.

Faire de même pour ces séquences avec une recherche microbienne trouve 92 microbes avec une correspondance à 100% avec le gène SARS-CoV-2 E et 100 microbes correspondants, avec une identité de séquence à 100%, avec le gène vital SARS-CoV-2 RdRp.

Chaque fois que nous vérifions les marqueurs génétiques dits uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, censées identifier le SRAS-CoV-2, ne sont pas uniques. Il peut s’agir de n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les  soi- disant  vérificateurs de faits , comme le  projet Health Feedback de Reuters  , ont rapidement rejeté les affirmations de  ceux qui ont remarqué le manque apparent de spécificité dans le génome supposé du SRAS-CoV-2.

En utilisant une multitude d’arguments d’homme de paille comme,  «cette affirmation suggère que chaque test devrait être positif»  (ce qui n’est pas le cas), leur   tentative de  démystification exécute quelque chose comme ceci :

Les amorces sont conçues pour se lier à des séquences nucléotidiques spécifiques qui sont uniques au virus. L’amorce sens peut se lier à un chromosome particulier, mais l’amorce inverse ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. De plus, parce que les amorces sens et pervers enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble délibérément déformer la signification de ces conclusions en transmettant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont  enquêté sur l’épidémiologie  des cas présumés marocains   de SRAS-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de le dire, beaucoup peuvent avoir été positifs pour aucun.

Ceci est entièrement conforme aux  directives de test de l’OMS . Ils déclarent:

«Un diagnostic optimal consiste en un NAAT [test d’amplification d’acide nucléique] avec au moins deux cibles indépendantes du génome du SRAS-CoV-2; cependant, dans les régions où la transmission est répandue, un algorithme simple à cible unique peut être utilisé… Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs de faits bien financés  ,  si les amorces avant et arrière identifient des indésirables, peut-être l’un étant le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée entre eux est probablement également indésirable.

L’argument selon lequel la RT-PCR ne trouve que l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression génique. Personne ne dit que des chromosomes entiers ou des microbes sont séquencés dans le génome présumé du SRAS-CoV-2. Bien qu’ils puissent, pour tout ce que nous savons. Ils disent que les marqueurs présumés, utilisés pour tester ce supposé virus, ne sont pas adaptés.

Les tests RT-PCR ne séquencent pas le génome entier. Ils recherchent des incidents de fluorescence de sonde spécifique pour indiquer la présence de séquences dites exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et sondes ne pouvaient rien révéler d’autre que des correspondances d’ARN extraites d’  ADN non codant, parfois appelé  «indésirable», ADN (ADNc).

Par exemple, le  gène SARS-CoV-2 S  est censé être hautement spécifique du génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité à 100%. La correspondance de pourcentage d’identité la plus faible, parmi les 100 premiers, est de 95%. Un BLAST du génome humain trouve également une correspondance de séquence à 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement ce que c’est. Le génome entier pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve que le SRAS-CoV-2 existe. Par conséquent, il n’y a pas non plus de preuve qu’une maladie appelée COVID 19 existe.

Cela signifie qu’il n’y a aucune base scientifique pour toute allégation concernant le nombre de cas de COVID 19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour  lutter contre  ce  virus mortel  sont très probablement fondées sur rien.


La fraude est un acte criminel. La  définition juridique  de la fraude est:

«Une pratique frauduleuse ou un acte délibéré, auquel on a eu recours avec l’intention de priver un autre de ses droits ou, d’une manière ou d’une autre, de lui causer des blessures.»

La définition légale d’un complot est:

« Une combinaison ou une confédération entre deux ou plusieurs personnes constituées en vue de commettre, par leurs efforts conjoints, un acte illégal ou criminel »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont fourni aucune preuve pour montrer qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID 19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut le lire.

Pour qu’il y ait fraude, la tromperie doit être volontaire. L’intention doit être de priver délibérément autrui de ses droits ou de lui porter atteinte d’une autre manière. S’il existe des preuves de collusion entre des individus et / ou des organisations pour commettre une fraude, il s’agit alors d’un complot (dans les juridictions de common law) ou d’une  entreprise criminelle commune  (ECC) en vertu du droit international.

Il semble que COVID 19 a été délibérément utilisé comme  casus belli  pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté d’errer restreinte, la liberté de parole et d’expression érodée, les droits de manifester restreints, séparés de nos proches, nos entreprises détruites, psychologiquement bombardées, muselées et terrorisées.

Pire encore, bien qu’il n’y ait  aucune preuve  de   mortalité toutes causes sans précédent , il y a eu des pics de décès non saisonniers. Celles-ci  correspondent précisément aux mesures de verrouillage  qui ont vu le retrait des services de santé pour lesquels nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire du COVID 19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’  humanité elle-même .

Pour être  autorisés  à participer à leur soi-disant  «nouvelle normalité»,  qui est la transformation globale de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci incluent, mais sans s’y limiter, la surveillance bio-métrique de tout le monde, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une revendication effective que nous n’avons pas droit à la souveraineté sur nos propres organes. Ceci constitue la  condition de l’esclavage .

Il ne fait aucun doute que nous avons été privés de nos droits et lésés. Dans les juridictions de common law, l’innocence est présumée, mais la preuve qu’un préjudice a été délibérément causé par un complot international est accablante. Les politiques destructrices, adoptées par les gouvernements du monde entier, sont clairement nées des groupes de réflexion mondialistes et des institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont collectivement été incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le COVID 19 est un mythe.

Les responsables du crime de complot en vue de commettre une fraude mondiale devraient être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que nous autres essayons de réparer les dommages qu’ils ont déjà infligés.

Article complémentaire montrant que le virus n’a jamais été isolé.

Encore un article de Réseau International sur le même sujet

Une réflexion sur « COVID19 – Preuve d’une fraude mondiale ! »

Votre commentaire

Entrez vos coordonnées ci-dessous ou cliquez sur une icône pour vous connecter:


Vous commentez à l’aide de votre compte Déconnexion /  Changer )

Image Twitter

Vous commentez à l’aide de votre compte Twitter. Déconnexion /  Changer )

Photo Facebook

Vous commentez à l’aide de votre compte Facebook. Déconnexion /  Changer )

Connexion à %s

%d blogueurs aiment cette page :