Les morts du C0VlD, un mensonge d’Etat ?

Christophe De Brouwer scrute depuis un an les chiffres du C0VlD. L’interview publiée ici est une exclusivité. Il est – malheureusement – le seul à faire ce travail. Dites vous toutefois, et surtout, que si ses conclusions avaient été pensées, réfléchies, débattues, nous ne serions pas là où nous en sommes – même si le monde tournait déjà mal bien avant. Pendant ce temps, des gens meurent de leurs politiques. C’est cela l’essentiel que nous devons retenir, pensons-nous.

Voici la version courte:

Sur le même sujet, voir aussi la Réunion publique du Conseil scientifique indépendant (CSI) du 15/04/2021

Dr. Sherri Tenpenny explique comment les vakx1s ARN-m risquent de commencer leurs effets dévastateurs dans 3 à 6 mois

Le Dr Sherri Tenpenny communique des informations TRÈS importantes !
La réponse hyper-immune chez les animaux de laboratoire lors des précédentes tentatives de vaccins contre les coronavirus, comme le SRAS et le MERS, est un problème persistant. Tout va bien pendant un certain temps, jusqu’à ce que les animaux soient exposés au virus sauvage muté. Le Dr Tenpenny et d’autres scientifiques prévoient que des millions de personnes pourraient mourir, et que l’on attribuera cette mort à une nouvelle souche de COVID, ce qui plaidera en faveur de vaccins encore plus mortels.
« Le génocide à venir des réactions indésirables aux vaccins COVID, et qui en sera tenu pour responsable ? »

https://odysee.com/@Abracadabra:3/Dr-Sherri-Tenpenny:1

Peter Mc Cullough – 85% de décès/malade en moins quand les patients sont traités précocement par un cocktail de médicaments.

Peter Mc Cullough, un des plus grands spécialistes dans ce qui concerne le coeur et les reins, professeur de médecine dans une université au Texas, fait un déclaration devant le sénat du Texas sur le traitement de la maladie et surtout les censures et les comportements des médias sur tout ce qui relève des traitements au profit d’une vakxination inutile et dangereuse.

https://odysee.com/@Covidbel:5/72bf22:f

Attention aux projets machiavéliques de ces apprentis sorciers

Les refus de vakxination pourraient être vakxinés à l’aide d’un test PCR, selon les confirmations de l’Université Johns Hopkins

Source: Sentinelle citoyenne

Il y a t’il un rapport avec le test PCR anal?

Test PCR / AFP

En janvier 2019, l’OMS a défini le nombre croissant de critiques de la vakxination comme l’une des dix plus grandes menaces pour la santé mondiale et depuis le fiasco sans précédent de la vakxination corona, le nombre de ceux qui ont refusé de vakxiner s’est littéralement multiplié. Pendant ce temps, la résistance se forme même au sein de l’établissement médical conventionnel.

L'Université Johns Hopkins confirme: les refus de vaccination peuvent être vaccinés à l'aide d'un test PCR!, image №1

Mais les cerveaux de l’OMS insistent sur une couverture vakxinale irréaliste d’au moins 70 pour cent. Divers experts et anciens journalistes grand public tels que John O’Sullivan avertissent maintenant que la campagne massive de tests PCR pourrait être un programme de vakxination déguisé par l’OMS. (voir Principia Scientific)

O’Sullivan fait référence à une nouvelle technologie développée à l’université Johns Hopkins et destinée à permettre des vakxinations secrètes à l’aide d’un test PCR. Inspirés par un ver parasite qui creuse ses dents acérées dans les intestins de son hôte, les chercheurs de Johns Hopkins ont développé de minuscules micro-dispositifs en forme d’étoile qui se fixent à la muqueuse de l’intestin et délivrent des médicaments dans le corps.

Ces minuscules appareils, connus sous le nom de «Theragrippers», sont constitués de métal et d’un film mince qui change de forme. Ils sont recouverts de cire de paraffine sensible à la chaleur et chacun n’est pas plus gros qu’une tache de poussière. (voir Fig.1)

Lorsque le revêtement de paraffine du Theragripper atteint la température corporelle, les appareils se ferment de manière autonome et se fixent à la paroi du côlon. L’action de fermeture fait que les minuscules dispositifs à six broches s’enfoncent dans la membrane muqueuse et adhèrent au côlon, où ils sont retenus et libèrent progressivement leurs charges utiles de médicaments dans le corps. Finalement, le Theragripper perd son emprise sur le tissu et est retiré de l’intestin via la fonction musculaire gastro-intestinale normale. Remarque: selon l’Université Johns Hopkins, les Theragrippers sont en fait administrés avec un écouvillon. (voir Fig.2)

L'Université Johns Hopkins confirme: les refus de vaccination peuvent être vaccinés à l'aide d'un test PCR!, image №2
figure 1: Theragripper

L’équipe de recherche de l’Université Johns Hopkins a publié les résultats positifs d’une étude animale en tant qu’article de couverture dans Science Advances, le 28 octobre 2020, confirmant que la nouvelle technologie fonctionne parfaitement:

Ici, nous rapportons que les pinces thérapeutiques mécanochimiques actives inspirées du parasite GI, ou theragrippers, peuvent survivre dans le tractus gastro-intestinal d’animaux vivants pendant 24 heures, en s’accrochant de manière autonome au tissu muqueux.

“Nous observons également une remarquable multiplication par six de la demi-vie d’élimination en utilisant la délivrance médiée par ripper du modèle analgésique kétorolac trométhamine. Ces résultats fournissent une preuve primordiale que les micro-dispositifs à changement de forme et autobloquants améliorent l’efficacité de l’administration prolongée de médicaments.”

L'Université Johns Hopkins confirme: les refus de vaccination peuvent être vaccinés à l'aide d'un test PCR!, image №3
figure 2

Par chance, le test PCR est désormais également effectué par voie anale en Chine car la fiabilité des résultats est meilleure et, bien sûr, cette pratique est immédiatement approuvée dans les médias grand public occidentaux. (voir Business Insider).

Remarque: Si vous ne pouvez pas imaginer que le gouvernement vous donnerait des substances toxiques contre votre volonté et sans votre consentement, vous devez vous souvenir de toutes les horribles expériences humaines qui ont été admises rétrospectivement et, selon Wikipédia, se sont bien déroulées dans les temps modernes.

En 2007, le CDC a même admis qu’entre 1955 et 1963, 10 à 30 millions de citoyens ont été infectés par le virus du cancer SV40 par le biais de la vakxination contre la polio.

Dans une conférence vidéo perspicace avec Dr. Judy Mikovits, Robert Kennedy Jr. et Dr. David Martin apprend que selon la définition légale, le vakx1 à ARNm n’est pas du tout un vakx1. On l’appelle à tort un vakx1 pour cacher le fait que le prétendu vakx1 est en fait une thérapie génique.

Le médecin et épidémiologiste expérimenté, Dr. Wolfgang Wodarg a déclaré dans une interview censurée avec Rubikon:

“En fait, ce vakx1 dit prometteur devrait être INTERDIT pour la grande majorité des gens, car il s’agit d’une manipulation génétique!”

Mary Holland, vice-présidente et avocate en chef de l’Organisation de défense de la santé des enfants, prévient:

“Les nouvelles technologies vakxinales entraîneront probablement de nouveaux types de dommages liés aux vakx1s. Puisqu’il n’y a jamais eu de vakx1 à ARNm homologué, nous ne savons vraiment pas à quoi ressembleront de tels dommages. Parce que les vakx1s ont été développés si rapidement dans des essais cliniques aussi courts, que les effets néfastes à long terme sont complètement inconnus.[…] Il est particulièrement effrayant que la plupart d’entre eux ne sachent même pas ce que fait le vakx1 ARNm dans leur corps. Ils peuvent simplement être vakxinés à l’aveugle, même si de plus en plus d’experts médicaux indépendants et même conventionnels mettent en garde contre cela.”

Dans ce contexte, il ne faut pas oublier que la société américaine modeRNA Therapeutics a été fondée en 2010 non pas en tant que fabricant de vakx1s, mais en tant que société GenTech. (voir Wikipedia) L’exemple des nombreux scandales Monsanto montre clairement que la manipulation génétique ne sert pas à protéger les espèces, mais plutôt au pouvoir.

L’agenda caché est de modifier génétiquement l’espèce afin de la breveter ou de la posséder. L’ancien secrétaire d’État américain Henry Kissinger a dit un jour: “Celui qui contrôle les semences gouverne le monde” (Cf. Portail de presse).

Et après? Vont-ils breveter notre corps après nous avoir génétiquement modifiés avec le vakx1 à ARNm?

Dr. Carrie Madej, spécialiste en médecine interne avec plus de 19 ans d’expérience, explique que le vakx1 COVID-19 pourrait en fait être un cheval de Troie, pour breveter les gens car il change notre ADN.

Selon un article publié en janvier 2020 dans le magazine scientifique britannique Phys.org, il est confirmé que l’ARN modifié a un impact direct sur notre ADN. Le passage suivant est particulièrement alarmant :

“ Plusieurs groupes de recherche travaillent maintenant ensemble pour étudier les effets ce que cela peut avoir sur la molécule d’ADN. Nous savons déjà que les régions de la boucle R sont associées à des séquences d’ADN qui contiennent des gènes actifs, et que cela peut conduire à des cassures chromosomiques et à la perte d’informations génétiques. Le fait que les principaux fabricants de vakx1s tels que Pfizer avertissent leurs sujets de ne pas se reproduire après la vakxination est également alarmant. (cf. Pfizer, p. 132) ”

Avec cela, la société pharmaceutique confirme que le vakx1 ARNm peut avoir des effets négatifs sur la reproduction humaine et qu’il faut toujours vakxiné!

Conclusion : Quiconque connaît un peu l’histoire sait que les expériences génétiques et les expériences humaines ne sont pas nouvelles. Alors que l’eugénisme moderne a ses origines au 19ème siècle, les idées, les mesures et les justifications des interventions et influences étatiques et sociales sur la reproduction sont connues depuis l’Antiquité.

On les trouve déjà dans la Politeia de Platon, qui, cependant, se limite à la sélection de l’État et à l’éducation. Des lignes de pensée correspondantes peuvent être trouvées dans les écrits utopiques sociaux Utopia de Thomas More, Nova Atlantis de Francis Bacon et La città del Sole de Tommaso Campanella.

Sandra Berset

Written by Sandra Berset

Le C0VlD n’existe pas: la preuve

« Stanford, Cornell et cinq autres laboratoires universitaires californiens « ont trouvé le C19 imaginaire, fictif, pas un virus et poursuivent le CDC pour fraude concernant le Covid », Rob Oswald, docteur en virologie et immunologie de l’université de Cornell :

« Ce à quoi nous avons affaire est donc juste une autre souche de grippe comme chaque année, le C19 n’existe pas et est fictif. Je crois que la Chine et les mondialistes ont orchestré ce canular de COVID (la grippe déguisée en nouveau virus) pour instaurer une tyrannie mondiale et un État de surveillance totalitaire de la police mondiale, et ce complot incluait une fraude électorale massive ».

« J’ai un doctorat en virologie et immunologie. Je suis un scientifique de laboratoire clinique et j’ai testé 1500 échantillons de C19 « supposés » positifs collectés ici en Californie du Sud. Lorsque mon équipe de laboratoire et moi-même avons effectué les tests selon les postulats de Koch et l’observation au MEB (microscope électronique à balayage), nous n’avons trouvé AUCUN Covid dans ces 1500 échantillons. Ce que nous avons constaté, c’est que les 1500 échantillons étaient pour la plupart des cas de grippe A et certains des cas de grippe B, mais pas un seul cas de Covid, et nous n’avons pas utilisé le test PCR B.S. »

« Nous avons ensuite envoyé le reste des échantillons à Stanford, Cornell et à quelques laboratoires de l’Université de Californie et ils ont trouvé les mêmes résultats que nous, PAS DE COVID. Ils ont trouvé la grippe A et B. Nous avons alors tous parlé au CDC et demandé des échantillons viables de COVID, que le CDC a dit ne pas pouvoir fournir car il n’avait pas d’échantillons ».

« Nous sommes maintenant parvenus à la ferme conclusion, grâce à toutes nos recherches et à notre travail en laboratoire, que le C19 était imaginaire et fictif. La grippe s’appelait Covid et la plupart des 225 000 personnes décédées l’ont été à la suite de comorbidités telles que des maladies cardiaques, le cancer, le diabète, l’emphysème, etc. Je n’ai pas encore trouvé un seul échantillon viable de C19 avec lequel travailler ».

« Nous, les sept universités qui avons effectué les tests de laboratoire sur ces 1500 échantillons, poursuivons maintenant le CDC pour fraude au C19. Le CDC ne nous a toujours pas envoyé un seul échantillon viable, isolé et purifié de C19. S’ils ne peuvent ou ne veulent pas nous envoyer un échantillon viable, je dis qu’il n’y a pas de C19, il est fictif. Les quatre documents de recherche qui décrivent les extraits génomiques du virus C19 n’ont jamais réussi à isoler et à purifier les échantillons. Les quatre articles écrits sur le C19 ne décrivent que de petits morceaux d’ARN qui ne faisaient que 37 à 40 paires de bases, ce qui n’est PAS UN VIRUS. Un génome viral est généralement constitué de 30 000 à 40 000 paires de bases ».

« Avec un taux d’infection aussi élevé que celui du Covid, comment se fait-il que personne, dans aucun laboratoire du monde, n’ait jamais isolé et purifié ce virus dans son intégralité ? C’est parce qu’ils n’ont jamais vraiment trouvé le virus, tout ce qu’ils ont trouvé, ce sont des petits morceaux d’ARN qui n’ont jamais été identifiés comme le virus de toute façon ».

En complément vidéo du Dr Kaufman (en anglais) expliquant les protocoles de Koch et Rivers pour prouver l’existence de virus pathogènes.

Autre complément: des scientifiques ne trouvent pas de virus dans 1500 échantillons considérés comme positifs. Cela est confirmé par d’autres collègues. De plus les organismes comme le CDC … avouent n’être pas en mesure de dispose d’échantillons isolés du virus !

Lien sur Bitchute: https://www.bitchute.com/video/9a2mmdnr3jB5/

Le fantôme du virus: à la recherche du Sars-Cov-2

Pour ceux qui veulent encore creuser la question de l’inexistence réelle du virus …

Traduction de l’article paru dans Off-Guardian du 31/1/21

Torsten Engelbrecht, Dr Stefano Scoglio et Konstantin Demeter

Même l’Institut Robert Koch et d’autres autorités sanitaires ne peuvent pas présenter de preuve décisive qu’un nouveau virus nommé SARS-CoV-2 nous hante. Cela seul transforme les discussions sur les mutations virales dangereuses en alarmistes irresponsables et les soi-disant tests PCR SARS-CoV-2 en une entreprise sans valeur.

Dans une demande d’étude qui montre l’isolement et la purification complets des particules prétendument SRAS-CoV-2, Michael Laue de l’un des représentants les plus importants au monde de la «panicdémique» COVID-19, l’Institut allemand Robert Koch (RKI ), a répondu que [ 1 ]:

Je ne connais pas de papier purifiant le SRAS-CoV-2 isolé.

C’est une déclaration plus que remarquable, elle admet un échec complet. Cette concession est conforme aux déclarations que nous avons présentées dans notre article «Les tests de PCR COVID-19 sont scientifiquement dénués de sens» qu’OffGuardian a publié le 27 juin 2020 – un article qui était le premier au monde décrivant en détail pourquoi la PCR SARS-CoV-2 les tests sont sans valeur pour le diagnostic d’une infection virale.

L’un des points cruciaux de cette analyse était que les études prétendant avoir montré que le SRAS-CoV-2 est un virus nouveau et potentiellement mortel n’ont pas le droit de le revendiquer, en particulier parce que les études revendiquant l ‘«isolement» du soi-disant SRAS-CoV-2 n’a en fait pas réussi à isoler (purifier) ​​les particules dites être le nouveau virus.

Ceci est confirmé par les réponses des scientifiques des études respectives à notre enquête, qui sont présentées dans un tableau de notre article – parmi lesquelles l’article le plus important au monde en ce qui concerne l’affirmation d’avoir détecté le SRAS-CoV-2 (par Zhu et al.), publié dans le New England Journal of Medicine le 20 février 2020 , et maintenant même le RKI.

Soit dit en passant, nous sommes en possession d’une autre réponse confirmative des auteurs [ 2 ] d’une étude australienne .

RECHERCHÉ, EN VAIN: VIRUS SRAS-COV-2

De plus, Christine Massey, une ancienne biostatisticienne canadienne dans le domaine de la recherche sur le cancer, et un de ses collègues en Nouvelle-Zélande, Michael Speth, ainsi que plusieurs personnes dans le monde (dont la plupart préfèrent rester anonymes) ont soumis au Freedom of Information des demandes adressées à des dizaines d’établissements sanitaires et scientifiques et à une poignée de bureaux politiques à travers le monde.

Ils recherchent des dossiers décrivant l’isolement d’un virus SRAS-COV-2 à partir de tout échantillon non altéré prélevé sur un patient malade.

Mais les 46 institutions / bureaux qui ont répondu n’ont absolument pas fourni ou cité aucun document décrivant l’isolement du «SRAS-COV-2»; et le ministère allemand de la Santé a complètement ignoré leur demande d’accès à l’information .

L’entrepreneur allemand Samuel Eckert a demandé aux autorités sanitaires de diverses villes telles que München (Munich), Düsseldorf et Zurich une étude prouvant l’isolement complet et la purification du soi-disant SRAS-CoV-2. Il ne l’a pas encore obtenu .

RÉCOMPENSES POUR PREUVE D’ISOLEMENT ET DE CAUSALITÉ

Samuel Eckert a même offert 230 000 € à Christian Drosten s’il peut présenter des passages de textes de publications qui prouvent scientifiquement le processus d’isolement du SRAS-CoV-2 et de sa substance génétique. La date limite (31 décembre 2020) est passée sans que Drosten ne réponde à Eckert .

Et une autre date limite est passée le 31 décembre sans soumission de la documentation souhaitée. Dans ce cas, le journaliste allemand Hans Tolzin a offert une récompense de 100 000 € pour une publication scientifique décrivant une tentative d’infection réussie avec le SARS-CoV-2 spécifique entraînant de manière fiable une maladie respiratoire chez les sujets de test.

LA VARIATION DE LA TAILLE DES PARTICULES RÉDUIT ÉGALEMENT L’HYPOTHÈSE VIRALE À L’ABSURDe

Récemment, nous sommes effrayés par de nouvelles souches présumées de «SRAS-CoV-2», mais cette affirmation n’est pas fondée sur une science solide.

Tout d’abord, vous ne pouvez pas déterminer une variante d’un virus si vous n’avez pas complètement isolé l’original.

Deuxièmement, il existe déjà des dizaines de milliers de nouvelles souches supposées , «trouvées» depuis l’hiver dernier dans le monde entier. En fait, la banque de données virales GISAID compte désormais plus de 452 000 séquences génétiques différentes qui prétendent représenter une variante du SRAS-Cov2 .

Donc, prétendre qu’il y a maintenant soudainement de «nouvelles souches» est de la pure folie, même d’un point de vue orthodoxe, parce que de ce point de vue, les virus mutent constamment. Ainsi, ils peuvent constamment proclamer avoir trouvé de nouvelles souches, perpétuant la peur.

Une telle peur est d’autant plus absurde que l’on jette un coup d’œil aux micrographies électroniques imprimées dans les études pertinentes, qui montrent des particules censées représenter le SRAS-CoV-2. Ces images révèlent que ces particules varient extrêmement en taille. En fait, la bande passante varie de 60 à 140 nanomètres (nm) . Un virus qui a une telle variation de taille extrême ne peut pas réellement exister.

Par exemple, on peut dire des êtres humains qu’ils varient d’environ 1,50 mètre à 2,10 mètres, car il y a plusieurs individus de différentes hauteurs. Maintenant, dire que les virus dans leur ensemble vont de 60 à 140 nm – comme l’ont fait Zhu et al. – peut éventuellement avoir un sens; mais dire que les virions individuels du SRAS-Cov2 varient autant serait comme dire que John varie sa taille de 1,60 à 2 mètres selon les circonstances!

On pourrait répondre que les virus ne sont pas des individus humains, mais il est également vrai que, selon la virologie, chaque virus a une structure assez stable. Ainsi, avec SARS-Cov2, ils prennent des libertés de définition qui confirment en outre que tout sur ce virus spécifique est encore plus aléatoire que d’habitude. Et cette licence de définition illimitée a conduit au fait que l’entrée de Wikipédia sur le coronavirus a été modifiée, et rapporte maintenant que «chaque virion du SRAS-CoV-2 a un diamètre d’environ 50 à 200 nm» .

Ce serait comme dire que John varie sa taille de 1 à 4 mètres selon les circonstances!

Ce que l’on fait passer pour le SRAS-Cov2 sont en fait des particules de toutes sortes, comme le montrent également les images fournies par l’article mentionné par Zhu et al. Ci-dessous, la photo que Zhu et al. présent comme la photo du SRAS-Cov2:

Grâce à un mètre de taille d’écran (FreeRuler), les particules que les auteurs attribuent au SARS-CoV-2 peuvent être mesurées. Les particules agrandies de la photographie de gauche mesurent environ 100 nm chacune (sur une échelle de 100 nm). Mais dans l’image de droite, toutes les petites particules indiquées par des flèches comme SARS-CoV-2, mesurées à une échelle de 1 MicroM (1000 nm), ont des tailles totalement différentes.

Les flèches noires indiquent en fait des vésicules. En mesurant certaines de ces particules avec la règle, le résultat est que dans la vésicule centrale, la particule la plus élevée au centre mesure près de 52 nm, donc en dessous de la gamme proposée par Zhu et al (60 à 140 nm); la particule immédiatement à sa droite mesure un peu plus, environ 57,5 ​​nm, mais toujours en dessous de la limite; tandis que, presque au centre de la vésicule la plus basse, la plus grosse particule (flèche jaune) mesure environ 73,7 nm, s’inscrivant dans les larges marges de Zhu et al .; enfin, dans la vésicule inférieure gauche, la plus grosse particule mesure un bon 155,6 nm, c’est-à-dire bien au-dessus de la limite maximale définie par Zhu et al. (140 nm).

Il est probable que la correction apportée récemment sur Wikipédia visait précisément à couvrir ce problème.

Il y a d’autres indications fortes que les particules appelées SARS-CoV-2 peuvent en fait être des particules inoffensives ou même utiles, appelées «vésicules extracellulaires» (VE), qui ont des dimensions extrêmement variables (de 20 à 10 000 nm), mais qui pour la plupart vont de 20 nm à 200 nm, et qui comprennent, en tant que sous-catégorie, celle des «exosomes».

Les exosomes sont des particules produites par nos cellules et contiennent des acides nucléiques, des lipides et des protéines , et sont impliqués dans diverses activités utiles à notre corps, telles que le transport de molécules immunitaires et de cellules souches, ainsi que l’élimination des débris cataboliques de la cellule .

Les exosomes représentent peut-être la plus grande part des véhicules électriques et font l’objet de nombreuses études depuis plus de 50 ans. Bien que peu d’entre eux aient entendu parler de ces particules bénéfiques, la littérature scientifique à leur sujet est énorme, et uniquement sur PubMed, si l’on tape «exosome», plus de 14 000 études sont fournies! Nous ne pouvons pas entrer dans les détails sur les VE et les exosomes ici, mais il est important de souligner comment ils sont indiscernables des virus, et plusieurs scientifiques pensent qu’en réalité ce qui est défini comme un virus dangereux n’est rien d’autre qu’un exosome bénéfique.

Ceci est immédiatement visible au microscope électronique [ 3 ]:

Comme on peut le voir, le plus grand des exosomes est de la même taille et de la même structure que le prétendu SRAS-CoV-2, et il est donc plausible de croire que, dans la grande mer de particules contenues dans le surnageant du COVID-19 liquide broncho-alvéolaire du patient, ce qui est considéré comme le SRAS-CoV-2 n’est qu’un exosome.

POURQUOI LA PURIFICATION EST VITALE POUR PROUVER QUE SARS-COV-2 EXISTE

Donc, logiquement, si nous avons une culture avec d’innombrables particules extrêmement similaires, la purification des particules doit être la toute première étape afin de pouvoir véritablement définir les particules que l’on pense être des virus comme des virus (en plus de la purification des particules, bien sûr , il faut alors aussi déterminer parfaitement, par exemple, que les particules peuvent provoquer certaines maladies dans des conditions réelles et pas seulement de laboratoire).

Par conséquent, si aucune «purification» de particules n’a été faite nulle part, comment peut-on prétendre que l’ARN obtenu est un génome viral? Et comment un tel ARN peut-il alors être largement utilisé pour diagnostiquer une infection par un nouveau virus, que ce soit par des tests PCR ou autrement? Nous avons posé ces deux questions à de nombreux représentants du récit officiel corona dans le monde entier, mais personne n’a pu y répondre.

D’où, comme nous l’avons indiqué dans notre article précédent, le fait que les séquences de gènes d’ARN – que les scientifiques ont extraites d’échantillons de tissus préparés dans leurs études in vitro et auxquelles les tests SRAS-CoV-2 RT-PCR ont finalement été  » calibré ”- appartenir à un nouveau virus pathogène appelé SARS-CoV-2 est donc basé sur la foi seule, pas sur des faits.

Par conséquent, il ne peut être conclu que les séquences génétiques d’ARN «extraites» des échantillons de tissus préparés dans ces études, sur lesquels les tests PCR sont «calibrés», appartiennent à un virus spécifique, en l’occurrence le SARS-CoV-2.

Au lieu de cela, dans toutes les études prétendant avoir isolé et même testé le virus, quelque chose de très différent a été fait: les chercheurs ont prélevé des échantillons dans la gorge ou les poumons de patients, les ultracentrifugés (lancés à grande vitesse) pour séparer le plus gros / lourd du plus petit / molécules plus légères, puis a pris le surnageant, la partie supérieure du matériel centrifugé.

C’est ce qu’ils appellent «isoler», auquel ils appliquent ensuite la PCR. Mais ce surnageant contient toutes sortes de molécules, des milliards de micro et nanoparticules différentes, y compris les vésicules extracellulaires (VE) et les exosomes susmentionnés, qui sont produits par notre propre corps et sont souvent tout simplement indiscernables des virus:

De nos jours, il est presque impossible de séparer les VE et les virus au moyen de méthodes canoniques d’isolement des vésicules, telles que l’ultracentrifugation différentielle, car ils sont fréquemment co-granulés en raison de leur dimension similaire

… Comme il est dit dans l’étude The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses publiée en mai 2020 dans la revue Viruses .

Ainsi, les scientifiques «créent» le virus par PCR: vous prenez des amorces, c’est-à-dire. les séquences génétiques déjà existantes disponibles dans les banques génétiques, vous les modifiez sur la base d’un raisonnement purement hypothétique, et les mettez en contact avec le bouillon surnageant, jusqu’à ce qu’elles se fixent (s’annelent) à un certain ARN dans le bouillon; puis, grâce à l’enzyme Reverse Transcriptase, vous transformez l’ARN ainsi «pêché» en un ADN artificiel ou complémentaire (ADNc), qui peut alors, et seulement alors, être traité par PCR et multiplié par un certain nombre de cycles de PCR.

(Chaque cycle double la quantité d’ADN, mais plus le nombre de cycles nécessaires pour produire du matériel de «virus» détectable est élevé, plus la fiabilité de la PCR est faible, c’est-à-dire sa capacité à «obtenir» réellement quelque chose de significatif du surnageant. 25 cycles, le résultat a tendance à être dénué de sens, et tous les tests ou protocoles de PCR en circulation actuels utilisent toujours bien plus de 25 cycles, en fait généralement 35 à 45.)

Pour aggraver les choses, les amorces sont constituées de 18 à 24 bases (nucléotides) chacune; le virus SARS-Cov2 est censé être composé de 30 000 bases; si l’amorce ne représente que 0,08 pour cent du génome du virus . Cela rend encore moins possible de sélectionner le virus spécifique que vous recherchez sur un terrain aussi minuscule, et de plus dans une mer de milliards de particules très similaires.

Mais il y a plus. Comme le virus que vous recherchez est nouveau, il n’y a manifestement pas d’amorces génétiques prêtes à correspondre à la fraction spécifique du nouveau virus; donc vous prenez des amorces qui, selon vous , peuvent être plus proches de la structure du virus hypothétique , mais c’est une supposition, et lorsque vous appliquez les amorces au bouillon surnageant, vos amorces peuvent se fixer à l’un des milliards de molécules présentes, et vous n’ont aucune idée que ce que vous avez ainsi généré est le virus que vous recherchez . Il s’agit en fait d’une nouvelle création faite par des chercheurs, qui l’appellent alors SARS-CoV-2, mais il n’y a aucun lien avec le virus présumé «réel» responsable de la maladie.

LE «GÉNOME DU VIRUS» N’EST RIEN D’AUTRE QU’UN MODÈLE INFORMATIQUE

Le génome complet du virus SARS-CoV-2 n’a jamais été séquencé et a plutôt été «reconstitué» sur l’ordinateur. Le médecin californien Thomas Cowan a qualifié cela de «fraude scientifique». Et il n’est pas le seul de loin!

Cowan a écrit le 15 octobre 2020:

Cette semaine, ma collègue et amie Sally Fallon Morell a porté à mon attention un article étonnant publié par le CDC , publié en juin 2020. Le but de l’article était pour un groupe d’une vingtaine de virologues de décrire l’état de la science de l’isolement, purification et caractéristiques biologiques du nouveau virus SRAS-CoV-2, et de partager ces informations avec d’autres scientifiques pour leurs propres recherches.

Une lecture approfondie et attentive de cet article important révèle des résultats choquants.

La section de l’article avec le sous-titre «Whole Genome Sequencing» a montré que «plutôt que d’avoir isolé le virus et de séquencer le génome de bout en bout» , le CDC «a conçu 37 paires de PCR imbriquées couvrant le génome sur la base de la référence du coronavirus séquence (numéro d’accès GenBank NC045512).

Alors, on peut se demander comment ont-ils séquencé le virus, c’est-à-dire. l’analyser génétiquement?

Eh bien, ils n’ont pas analysé tout le génome, mais ont plutôt pris des séquences trouvées dans les cultures, ont affirmé sans preuve qu’elles appartenaient à un nouveau virus spécifique, puis ont fait une sorte de puzzle informatique génétique pour remplir le reste. « Ils utilisent la modélisation informatique pour créer essentiellement un génome à partir de rien », comme le dit le biologiste moléculaire Andrew Kaufman .

Il n’est peut-être pas surprenant que l’une des amorces du test développé par l’ Institut Pasteur corresponde exactement à une séquence du chromosome 8 du génome humain .

AUCUNE PREUVE QUE SARS-COV-2 PEUT VOLER

Soi-disant pour arrêter la propagation du prétendu nouveau virus, nous sommes obligés de pratiquer diverses formes de distanciation sociale et de porter des masques. Derrière cette approche se cache l’idée que les virus et en particulier le SRAS-CoV-2, supposé être responsable de la maladie respiratoire Covid-19, se transmettent par voie aérienne ou, comme on l’a dit plus souvent, par les gouttelettes nébulisées dans ceux qui toussent, éternuent ou, selon certains, parlent simplement.

Mais la vérité est que toutes ces théories sur la transmission du virus ne sont que des hypothèses qui n’ont jamais été prouvées.

La preuve en était absente depuis le début. Comme le rapporte Nature dans un article d’avril 2020 , les experts ne sont pas d’accord pour dire que le SRAS-CoV-2 est aéroporté et, selon l’OMS elle-même, «les preuves ne sont pas convaincantes».

Même d’un point de vue orthodoxe, les seules études dans lesquelles la transmission d’un coronavirus (et non le SRAS-Cov2) par voie aérienne a été au préalable «prouvée» ont été menées dans des hôpitaux et des maisons de retraite , dans des lieux qui seraient tous responsables types d’infections dues aux conditions d’hygiène.

Mais aucune étude n’a jamais prouvé qu’il y avait transmission de virus dans des environnements ouverts, ou dans des environnements fermés mais bien ventilés. Même à supposer qu’il y ait cette transmission par voie aérienne, il a été souligné que, pour que la «contagion» se produise, il est nécessaire que les personnes entre lesquelles se produit la transmission présumée soient en contact étroit pendant au moins 45 minutes .

Bref, toutes les mesures radicales de distanciation n’ont aucun fondement scientifique.

AUCUNE «INFECTION» ASYMPTOMATIQUE

Étant donné que la purification des particules est la condition préalable indispensable pour les étapes ultérieures, c’est-à-dire la preuve de causalité et «l’étalonnage» des tests, nous avons un test insignifiant sur le plan diagnostique et donc le mantra «test, test, test» par Tedros Adhanom Ghebreyesus de l’OMS, mentionné dans notre article du 27 juin, doit être qualifié de non scientifique et trompeur.

Cela est particulièrement vrai pour les tests de personnes sans symptômes. Dans ce contexte même une étude chinoise de Wuhan publiée dans Nature le 20 novembre 2020, dans laquelle près de 10 millions de personnes ont été testées et tous les cas positifs asymptomatiques, les cas re-positifs et leurs contacts étroits ont été isolés pendant au moins 2 semaines jusqu’à la PCR résultat négatif, a révélé que:

Tous les contacts étroits des cas positifs asymptomatiques se sont révélés négatifs, ce qui indique que les cas positifs asymptomatiques détectés dans cette étude étaient peu susceptibles d’être infectieux.

Même le British Medical Journal orthodoxe s’est récemment joint à la critique.

Peu avant Noël, le magazine scientifique a publié l’article « COVID-19: les tests de masse sont inexacts et donnent un faux sentiment de sécurité, admet le ministre » expliquant comment les tests déployés dans certaines régions du Royaume-Uni ne sont tout simplement pas précis pour les personnes asymptomatiques arguant qu’il ne peut pas déterminer avec précision si l’un est positif ou négatif, comme l’écrit Collective Evolution . (L’OMS elle-même l’a depuis admis Deux fois )

Déjà quelques semaines auparavant, vous pouviez lire dans The BMJ que :

Les tests de masse pour COVID-19 est un désordre non évalué, sous-conçu et coûteux,

Et:

Le dépistage du COVID-19 dans la population en bonne santé est d’une valeur inconnue, mais est en cours d’introduction à l’échelle nationale

Et que:

«La riposte du Royaume-Uni à la pandémie repose trop largement sur des scientifiques et d’autres personnes nommées par le gouvernement aux intérêts concurrents inquiétants, y compris des participations dans des sociétés qui fabriquent des tests de diagnostic, des traitements et des vaccins covid-19

En dehors de cela, l’avocat Reiner Füllmich, membre de la commission d’enquête extra-parlementaire allemande «Stiftung Corona Ausschuss», a déclaré que Stefan Hockertz, professeur de pharmacologie et de toxicologie, lui avait dit qu’aucune preuve scientifique n’avait été trouvée pour une infection asymptomatique .

Lorsqu’on lui a posé la question, l’Institut Robert Koch n’a pas été en mesure de nous envoyer une seule étude démontrant que (a) les personnes asymptomatiques «positives» rendaient quelqu’un d’autre malade (pas seulement «positives»), que (b) les personnes «positives» présentant des symptômes de maladie quelqu’un d’autre malade (pas seulement «positif»), et que (c) toute personne qui a été testée «positive» pour le SRAS-CoV-2 a rendu une autre personne «positive». [ 4 ]

« SI VOUS NE TESTIEZ PLUS, LE CORONA DISPARAÎTRAIT »

Même en mai, une publication majeure telle que le Journal of the American Medical Association a déclaré qu’un résultat de PCR «positif» n’indique pas nécessairement la présence d’un virus viable », tandis qu’une étude récente dans The Lancet indique que « la détection d’ARN ne peut pas être utilisée pour déduire la contagiosité. « 

Dans ce contexte, on ne peut qu’être d’accord avec Franz Knieps, responsable de l’association des caisses d’assurance maladie des entreprises en Allemagne et depuis de nombreuses années en contact étroit avec la chancelière allemande Angela Merkel, qui a déclaré mi-janvier que «si vous ne testiez plus , Corona disparaîtrait. « 

Fait intéressant, même le virus-tsar allemand hyper-orthodoxe et principal conseiller du gouvernement sur les verrouillages et autres mesures, Christian Drosten, s’est contredit sur la fiabilité des tests PCR. Dans une interview de 2014 concernant les tests PCR pour le soi-disant MERS-CoV en Arabie saoudite, il a déclaré:

La méthode [PCR] est si sensible qu’elle peut détecter une seule molécule héréditaire du virus. Par exemple, si un tel agent pathogène se trouve juste à traverser la membrane nasale d’une infirmière pendant une journée sans qu’elle tombe malade ou ne remarque rien, alors elle est soudainement un cas de MERS. Là où des décès étaient précédemment signalés, les cas désormais bénins et les personnes en parfaite santé sont soudainement inclus dans les statistiques de déclaration. Cela pourrait également expliquer l’explosion du nombre de cas en Arabie saoudite. De plus, les médias locaux ont porté l’affaire à des niveaux incroyables. »

Cela vous semble vaguement familier?

Et même Olfert Landt critique les résultats des tests PCR, affirmant que seulement la moitié environ des personnes «infectées par corona» sont contagieuses . Ceci est plus que remarquable car Landt n’est pas seulement l’un des co-auteurs de Drosten dans Corman et al. papier – le premier protocole de test PCR accepté par l’OMS, publié le 23 janvier 2020 dans Eurosurveillance – mais aussi le PDG de TIB Molbiol, la société qui produit les tests selon ce protocole .

Malheureusement, ce conflit d’intérêts n’est pas mentionné dans l’étude Corman / Drosten et al. article, comme 22 scientifiques – parmi eux l’un des auteurs de cet article, Stefano Scoglio – ont critiqué dans une récente analyse approfondie .

Au total, Scoglio et ses collègues ont trouvé «de graves conflits d’intérêts pour au moins quatre auteurs», dont Christian Drosten, ainsi que diverses failles scientifiques fondamentales. C’est pourquoi ils ont conclu que «le comité de rédaction d’Eurosurveillance n’a d’autre choix que de retirer la publication».

Le 11 janvier 2021, la rédaction d’Eurosurveillance a répondu à l’e-mail de Torsten Engelbrecht demandant un commentaire sur cette analyse:

Nous sommes au courant d’une telle demande [de rétractation du Corman / Drosten et al. paper] mais nous espérons que vous comprendrez que nous ne faisons actuellement aucun commentaire à ce sujet. Cependant, nous travaillons à une décision d’ici la fin janvier 2021.

Le 27 janvier, Engelbrecht s’est de nouveau adressé au journal pour lui demander: «C’est maintenant la fin du mois de janvier. Alors permettez-moi de vous demander à nouveau: quel est votre commentaire sur l’analyse mentionnée de votre Corman / Drosten et al. papier? Et allez-vous retirer le Corman et al. papier – ou qu’allez-vous faire? Deux jours plus tard, la rédaction d’Eurosurveillance a répondu comme suit:

Cela prend du temps car plusieurs parties sont impliquées. Nous communiquerons notre décision dans l’un des prochains numéros réguliers de la revue.

DES MILLIARDS ET DES MILLIARDS GASPILLÉS SUR DES TESTS QUI NE PEUVENT PAS SIGNIFIER MOINS

Compte tenu du manque de faits pour la détection du nouveau virus présumé et pour que les tests PCR SARS-CoV-2 aient un sens, il est d’autant plus scandaleux que les coûts des tests ne sont pas discutés publiquement , car ils sont énormes. Souvent, nous entendons des politiciens et des chefs qui disent que répondant à certains critères, les tests sont gratuits, mais c’est un mensonge pur et simple. Ce qu’ils veulent dire, c’est que vous ne payez pas sur place mais avec vos impôts .

Mais quel que soit le mode de paiement, en Suisse, par exemple, le coût d’un test PCR est compris entre 140 CHF et 200 CHF (117 £ à 167 £). Alors, faisons le calcul. Au moment de la rédaction de cet article, la minuscule Suisse, avec une population de 8,5 millions d’habitants, a effectué environ 3 730 000 tests PCR SARS-CoV-2, en plus d’environ 500 000 tests antigéniques, qui sont un peu moins chers .

Compte tenu d’un prix moyen de 170 CHF par test PCR, cela représente un montant stupéfiant de 634 millions de CHF, soit 521 millions de £. Et malgré l’absurdité de tester des personnes asymptomatiques, la semaine dernière, le 27 janvier, le Conseil fédéral suisse a de nouveau appelé les personnes à se faire dépister. Annonçant que, dès le lendemain, les Suisses devront également payer avec leurs impôts pour des tests de masse sur des personnes asymptomatiques. Le Conseil fédéral suisse estime que cela coûtera environ 1 milliard de francs suisses .

L’épidémiologiste Dr Tom Jefferson a déclaré dans une interview au Daily Mail :

La plupart des kits PCR coûtent toujours plus de 100 £ à obtenir par le secteur privé, par exemple, et le gouvernement [britannique] dit qu’il en livre désormais 500 000 par jour. Mais même ces chiffres sont éclipsés par les 100 milliards de livres sterling que le Premier ministre est prêt à dépenser pour un rêve «  lunaire  » de fournir à la population des tests [PCR et autres types – ndlr.] Plus ou moins à la demande – seulement 29 milliards de livres de moins que le budget annuel de l’ensemble du NHS.

En Allemagne, le prix varie considérablement, selon également si le test est payé en privé ou non, mais en moyenne, il est similaire à ceux en GB, et à ce jour, ils ont effectué environ 37,5 millions de tests PCR .

C’est-à-dire que des milliards et des milliards sont dépensés – ou carrément «brûlés» – sur des tests qui ne peuvent pas signifier moins et qui alimentent la «chasse au cerf» moléculaire et numérique du monde entier pour un virus qui n’a jamais été détecté.

Torsten Engelbrecht est un journaliste d’investigation de Hambourg, en Allemagne. La nouvelle édition considérablement élargie de son livre «Virus Mania» (co-écrit avec le Dr Claus Köhnlein MD, le Dr Samantha Bailey MD et le Dr Stefano Scolgio BSc PhD) sera disponible début février. En 2009, il a remporté le prix allemand des médias alternatifs . Il était membre du personnel du Financial Times Deutschland et a également écrit pour OffGuardian, The Ecologist, Rubikon, Süddeutsche Zeitung et bien d’autres. Son site Web est www.torstenengelbrecht.com .


Le Dr Stefano Scoglio, BSc PhD, est un expert en microbiologie et naturopathie et coordonne la recherche scientifique et clinique sur les extraits d’algues Klamath et sur les probiotiques à base de microalgues, en coopération avec le Centre national de recherche italien et diverses universités. Depuis 2004, il a publié de nombreux articles dans des revues scientifiques internationales. En 2018, Scoglio a été nominé pour le prix Nobel de médecine.

Konstantin Demeter est photographe indépendant et chercheur indépendant. Avec le journaliste Torsten Engelbrecht, il a publié des articles sur la crise du «COVID-19» dans le magazine en ligne Rubikon, ainsi que des contributions sur le système monétaire, la géopolitique et les médias dans des journaux suisses italiens.

REMARQUES:-

  • [1] E-mail du 4 septembre 2020 [RETOUR]
  • [2] Courriel du 5 octobre 2020 [RETOUR]
  • [3] Les images sont tirées d’une présentation du Dr Andrew Kaufman, Ohio, l’un des principaux partisans de la théorie selon laquelle les virus sont en fait des exosomes. [ARRIÈRE]
  • [4] Courriel du 3 décembre 2020 [RETOUR]

Image d’en-tête: Alfred Abel, Rudolf Klein-Rogge et Gertrude Welcker dans Dr.Mabuse, der Spieler (1922)

En compléments:

– une vidéo de l’interview (en anglais) du Professeur Stefano Scoglio
– un article de Réseau International intitulé « Une nouvelle souche de coronavirus ou tromperie colossale. Un mirage peut-il en cacher un autre? « 

Le pourcentage annoncé d’efficacité des vakx1 remis en cause

Peter Doshi: Les vakx1 «efficaces à 95%» de Pfizer et Moderna – nous avons besoin de plus de détails et des données brutes

Traduction d’un article paru le 13/1/21 sur https://weehingthong.org/

4 janvier 2021

Il y a cinq semaines, lorsque j’ai  soulevé des questions  sur les résultats des essais de vakx1 covid-19 de Pfizer et Moderna, tout ce qui était dans le domaine public était les  protocoles d’étude  et  quelques  communiqués de  presse . Aujourd’hui, deux  publications de revues   et environ 400 pages de données de synthèse sont disponibles sous la forme de  multiples rapports présentés par  et  à la FDA  avant l’autorisation d’urgence par l’agence du vakx1 ARNm de chaque entreprise. Si certains détails supplémentaires sont rassurants, d’autres ne le sont pas. Ici, je souligne les nouvelles préoccupations concernant la fiabilité et la signification des résultats d’efficacité rapportés.     

« Covid-19 suspecté »

Toute l’attention s’est concentrée sur les résultats d’efficacité spectaculaires: Pfizer a signalé 170 cas de covid-19 confirmés par PCR, répartis de 8 à 162 entre les groupes vakx1 et placebo.
Mais ces chiffres étaient éclipsés par une catégorie de maladie appelée «covid-19 suspectée» – ceux avec un covid-19 symptomatique qui n’ont pas été confirmés par PCR. Selon  le rapport de la FDA sur le vakx1 de Pfizer , il y a eu «3410 cas au total de covid-19 soupçonnés, mais non confirmés, dans la population globale de l’étude, 1594 sont survenus dans le groupe vakxiné contre 1816 dans le groupe placebo.

Avec 20 fois plus de cas suspects que de cas confirmés, cette catégorie de maladie ne peut être ignorée simplement parce qu’il n’y avait pas de résultat positif au test PCR. En effet, cela rend d’autant plus urgent à comprendre. Une estimation approximative de l’efficacité du vakx1 contre le développement des symptômes de la covid-19, avec ou sans résultat positif au test PCR, serait une réduction du risque relatif de 19% (voir note de bas de page) – bien en dessous du seuil d’efficacité de 50% pour l’autorisation fixé  par les  régulateurs . Même après élimination des cas survenus dans les 7 jours suivant la vakxination (409 sous le vakx1 Pfizer vs 287 sous placebo), qui devraient inclure la majorité des symptômes dus à la réactogénicité du vakx1 à court terme, l’efficacité du vakx1 reste faible: 29% (voir note de bas de page).

Si plusieurs ou la plupart de ces cas suspects concernaient des personnes dont le résultat du test PCR était faussement négatif, cela réduirait considérablement l’efficacité du vakx1. Mais étant donné que les maladies de type grippal  ont  toujours  eu une  myriade de  causes – rhinovirus, virus grippaux, autres coronavirus, adénovirus, virus respiratoire syncytial, etc. – certains ou plusieurs des cas suspects de covid-19 peuvent être dus à un agent causal différent.

Mais pourquoi l’étiologie devrait-elle avoir de l’importance? Si ceux qui ont subi une «covid-19 suspectée» avaient essentiellement la même évolution clinique que la covid-19 confirmée, alors «la covid-19 suspectée et confirmée» pourrait être un critère d’évaluation plus significatif sur le plan clinique que la simple covid-19 confirmée.

Cependant, si la covid-19 confirmée est en moyenne plus sévère que la covid-19 suspectée, il faut quand même garder à l’esprit qu’en fin de compte, ce n’est pas la gravité clinique moyenne qui compte, c’est l’incidence de la maladie grave qui affecte les admissions à l’hôpital. Avec 20 fois plus de covid-19 suspectée que de covid-19 confirmée, et des essais  non conçus pour évaluer  si les vakx1 peuvent interrompre la transmission virale, une analyse de la maladie grave indépendamment de l’agent étiologique – à savoir, les taux d’hospitalisation, les cas de soins intensifs et les décès parmi les participants aux essais – semble justifié, et c’est le seul moyen d’évaluer la capacité réelle des vakx1 à surmonter la pandémie.

Il existe un besoin évident de données pour répondre à ces questions, mais le rapport de 92 pages de Pfizer ne mentionnait pas les 3410 cas de «covid-19 suspectés». Ni sa  publication  dans le  New England Journal of Medicine . Aucun des rapports sur le vakx1 de Moderna non plus. La seule source qui semble l’avoir signalé est l’examen du vakx1 de Pfizer par la FDA.

Les 371 personnes exclues de l’analyse de l’efficacité du vakx1 Pfizer

Une autre raison pour laquelle nous avons besoin de plus de données est d’analyser un détail inexpliqué trouvé dans un tableau de  l’examen par la FDA du  vakx1 de Pfizer: 371 personnes exclues de l’analyse d’efficacité pour «des écarts de protocole importants sur ou avant 7 jours après la dose 2.» Ce qui est préoccupant, c’est le déséquilibre entre les groupes randomisés dans le nombre de ces individus exclus: 311 du groupe vakx1 contre 60 sous placebo. (En revanche, dans  l’essai de Moderna , il n’y avait que 36 participants exclus de l’analyse d’efficacité pour «écart majeur du protocole» – 12 groupes vakxinaux contre 24 groupes placebo.)

Quels étaient ces écarts de protocole dans l’étude de Pfizer et pourquoi y avait-il cinq fois plus de participants exclus dans le groupe vakxiné? Le  rapport de la FDA  ne le dit pas, et ces exclusions sont difficiles à même repérer dans  le rapport  et la  publication de la revue Pfizer .

Les médicaments contre la douleur, la levée de l’aveuglement et les comités d’évaluation des événements primaires

Le mois dernier,  j’ai exprimé mon inquiétude quant au rôle de confusion potentiel des médicaments contre la douleur et la fièvre pour traiter les symptômes. J’ai émis l’hypothèse que ces médicaments pourraient masquer les symptômes, conduisant à une sous-détection des cas de covid-19, peut-être en plus grand nombre chez les personnes qui ont reçu le vakx1 dans un effort pour prévenir ou traiter les événements indésirables. Cependant, il semble que leur potentiel de résultats de confonds a été assez limité: bien que les résultats indiquent que ces médicaments ont été prises autour  de 3 – 4  fois plus souvent dans le vakx1 contre ayant reçu le placebo (au moins pour le vakx1-Moderna de Pfizer n’a pas rapport aussi clairement), leur l’utilisation était vraisemblablement concentrée au cours de la première semaine après l’utilisation du vakx1, prise pour soulager les événements indésirables locaux et systémiques post-injection. Mais l’ incidence cumulée  Les courbes  suggèrent un taux assez constant de cas confirmés de covid-19 au fil du temps, les dates d’apparition des symptômes s’étendant bien au-delà d’une semaine après l’administration.

Cela dit, le taux plus élevé d’utilisation de médicaments dans le groupe des vakx1 fournit une raison supplémentaire de s’inquiéter de la levée de l’insu. Compte tenu de la réactogénicité des vakx1, il est difficile d’imaginer que les participants et les chercheurs ne puissent pas deviner avec certitude dans quel groupe ils se trouvaient. Le principal critère d’évaluation des essais est relativement subjectif, ce qui fait de la levée de l’anonymat une préoccupation importante. Pourtant, ni la FDA ni les sociétés ne semblent avoir formellement sondé la fiabilité de la procédure d’aveuglement et ses effets sur les résultats déclarés.

Nous n’en savons pas non plus suffisamment sur les processus des comités d’arbitrage des événements primaires qui comptaient les cas de covid-19. Ont-ils été ignorés des données sur les anticorps et des informations sur les symptômes des patients au cours de la première semaine suivant la vakxination? Quels critères ont-ils utilisés, et pourquoi, avec un événement primaire consistant en un résultat rapporté par le patient (symptômes de covid-19) et un résultat de test PCR, un tel comité était-il même nécessaire? Il est également important de comprendre qui faisait partie de ces comités. Bien que Moderna ait  nommé  son comité de sélection de quatre membres – tous médecins affiliés à l’université – le protocole de Pfizer indique que  trois employés de Pfizer ont  fait le travail. Oui, les membres du personnel de Pfizer.

Efficacité du vakx1 chez les personnes qui avaient déjà un covid?

Les personnes ayant des  antécédents connus d’infection par le SRAS-CoV-2  ou  un diagnostic antérieur de Covid-19  ont été exclues des essais de Moderna et Pfizer. Mais encore 1125 ( 3,0% ) et 675 ( 2,2% ) des participants aux essais de Pfizer et Moderna, respectivement, ont été jugés positifs pour le SRAS-CoV-2 au départ.

La sécurité et l’efficacité des vakx1 chez ces receveurs n’ont pas reçu beaucoup d’attention, mais comme des parties de plus en plus importantes de la population de nombreux pays peuvent être «post-Covid», ces données semblent importantes – et d’autant plus que les  CDC américains recommandent d’  offrir le vakx1 d’antécédents d’infection par le SRAS-CoV-2 symptomatique ou asymptomatique. » Cela fait suite aux conclusions de l’agence  , concernant le vakx1 de Pfizer, selon lequel il avait une efficacité ≥ 92% et «aucun problème de sécurité spécifique» chez les personnes ayant déjà été infectées par le SRAS-CoV-2.

D’après mes calculs, Pfizer a apparemment signalé 8 cas de Covid-19 symptomatiques confirmés chez des personnes séropositives au SRAS-CoV-2 au départ (1 dans le groupe vakx1, 7 dans le groupe placebo, en utilisant les différences  entre les tableaux 9 et 10 ) et Moderna, 1 cas (groupe placebo;  tableau 12 ).

Mais avec seulement environ  quatre  à  31  réinfections documentées dans le monde, comment, dans des essais sur des dizaines de milliers, avec un suivi médian de deux mois, pourrait-il y avoir neuf cas confirmés de covid-19 parmi ceux atteints d’une infection par le SRAS-CoV-2 au départ? Est-ce représentatif d’une efficacité vakxinale significative, comme le CDC semble l’avoir approuvé? Ou pourrait-il s’agir d’autre chose, comme la prévention des symptômes de la covid-19, éventuellement par le vakx1 ou par l’utilisation de médicaments qui suppriment les symptômes, et rien à voir avec la réinfection?

Nous avons besoin des données brutes

Pour répondre aux nombreuses questions ouvertes sur ces essais, il  faut accéder aux données d’essai brutes . Mais aucune entreprise ne semble avoir partagé de données avec des tiers à ce stade.

Pfizer déclare  mettre les données à disposition « sur demande et sous réserve de révision ». Cela évite de rendre les données accessibles au public, mais laisse au moins la porte ouverte. L’ouverture n’est pas claire, car le protocole de l’  étude  indique que Pfizer ne commencera à rendre les données disponibles que 24 mois après la fin de l’étude.

La déclaration de partage de données de Moderna   indique que les données «peuvent être disponibles sur demande une fois l’essai terminé». Cela se traduit entre le milieu et la fin de 2022, car un suivi est prévu sur 2 ans.

Les choses peuvent ne pas être différentes pour le  vakx1 Oxford / AstraZeneca, qui a promis des données au niveau des patients  «lorsque l’essai est terminé». Et l’  entrée ClinicalTrials.gov  pour le vakx1 russe Spoutnik V indique qu’il n’est pas prévu de partager les données individuelles des participants.

L’  Agence européenne des médicaments  et  Santé Canada peuvent toutefois partager les données de tout vakx1 autorisé beaucoup plus tôt. L’EMA s’est déjà engagée à publier les données soumises par Pfizer sur son site Web  «en temps voulu», tout  comme  Santé Canada .

Peter Doshi , rédacteur en chef adjoint, The BMJ

Intérêts concurrents:  J’ai poursuivi la diffusion publique des protocoles d’essais de vakx1 et j’ai cosigné des lettres ouvertes appelant à l’indépendance et à la transparence dans la prise de décision relative au vakx1 covid-19.

note de bas de page

Les calculs de cet article sont les suivants: 19% = 1 – (8 + 1594) / (162 + 1816); 29% = 1 – (8 + 1594 – 409) / (162 + 1816 – 287). J’ai ignoré les dénominateurs car ils sont similaires entre les groupes.

Peter Doshi: Les vakx1 «efficaces à 95%» de Pfizer et Moderna – nous avons besoin de plus de détails et des données brutes

La phase la plus importante et la plus significative des essais sur le vakx1 CV-19 a à peine commencé, et est encore moins terminée

Publié le 3 janv.2021 sur le site off-guardian.org

Traduction française (automatique):

Quels essais de vakx1s? La phase la plus importante et la plus significative des essais sur le vakx1 CV-19 a à peine commencé, et est encore moins terminée
Iain Davis

Les essais de vakx1 COVID 19 semblent avoir semé la confusion. Espérons que cet article pourrait aider à clarifier un peu les choses. Les gens semblent vraiment croire que les vakx1 COVID 19 ont fait l’objet d’essais cliniques et se sont avérés à la fois sûrs et efficaces. Cette croyance est tout simplement fausse. Le point principal est le suivant. Si vous décidez d’avoir le vakx1 BNT162b2 (BNT) à base d’ARNm expérimental de Pfizer et BioNTech , ou tout autre vakx1 COVID 19 revendiqué d’ailleurs, vous êtes un sujet de test dans un essai de médicament.

L’ARNm du vakx1 BNT a été séquencé à partir de la troisième itération du génome SARS-CoV-2 publié par WUHAN original (MN908947.3). Cependant, les protocoles de l’OMS utilisés par Pfizer pour produire l’ARNm ne semblent pas identifier de séquences nucléotidiques uniques au virus SARS-CoV-2. Lorsque l’ enquêteur Fran Leader a interrogé Pfizer, ils ont confirmé:

La matrice d’ADN ne provient pas directement d’un virus isolé d’une personne infectée.

Il n’y a pas non plus d’essais cliniques terminés pour ces vakx1. Les essais sont en cours. Si vous en avez un, vous êtes le cobaye. Cela peut vous convenir, mais ce n’est pas un acte de foi que moi ou mes proches souhaitent entreprendre. Cependant, tout le monde est différent.

Le 8 décembre, la BBC a rapporté une étude dans le Lancet et a déclaré catégoriquement:

Le vakx1 Oxford / AstraZeneca Covid est sûr et efficace, offrant une bonne protection, ont confirmé les chercheurs

La BBC n’avait aucune justification pour faire cette affirmation. L’ étude du Lancet n’a rien confirmé de tel. Les chercheurs ont écrit:

ChAdOx1 nCoV-19 a un profil d’innocuité acceptable et s’est avéré efficace contre le COVID-19 symptomatique dans cette analyse intermédiaire des essais cliniques en cours.

Il s’agissait d’une analyse intermédiaire financée, entre autres, par le CEPI et la Fondation Bill et Melinda Gates. L’analyse était basée sur des essais qui sont des années à compter de la fin et n’ont rien rapporté. Les chercheurs ont également déclaré:

Aucune publication évaluée par des pairs n’était disponible sur l’efficacité des vakx1 contre le coronavirus 2 (SRAS-CoV-2) contre le syndrome respiratoire aigu sévère…

Il n’y a aucune preuve scientifique claire établissant l’innocuité ou l’efficacité des vakx1 COVID 19 proposés. La BBC et d’autres MSM rapportent que ces preuves existent sont fausses.

Nous allons nous concentrer sur le vakx1 BNT de Pfizer et BioNTech mais tous les fabricants ont essentiellement exploité la même astuce. Les régulateurs et les gouvernements ont travaillé avec les sociétés pharmaceutiques pour associer les données limitées des essais initiaux, ou de phase un, avec la collecte de données incomplète et continue des essais de phase deux et trois beaucoup plus importants. Les HARSAH ont alors faussement affirmé que les essais de phase 1, 2, 3 étaient terminés et ont insinué que les données non testées démontraient l’efficacité et l’innocuité du vakx1.

En réalité, non seulement la communication des données existantes a été manipulée pour montrer une efficacité qui n’est pas évidente dans les données brutes elles-mêmes, mais les phases les plus importantes et significatives des essais ont à peine commencé, et encore moins achevées.

Récemment, le Financial Times britannique a rapporté que les régulateurs britanniques (la MHRA) devraient approuver le vakx1 Astrazeneca / Oxfords AZD1222 [ChAdOx1] COVID 19. Le FT a révélé une déclaration anonyme du ministère britannique de la Santé:

Le régulateur des médicaments examine les données finales des essais cliniques de phase 3 de l’Université d’Oxford / AstraZeneca pour déterminer si le vakx1 répond à leurs normes strictes de qualité, de sécurité et d’efficacité.

Donnant ainsi au public l’impression que les essais sont terminés et que les régulateurs ont des normes de sécurité strictes. L’essai de phase 1,2,3 pour AZD1222 a été enregistré auprès du US Center for Disease Control en tant qu’essai clinique NCT04516746 [Archivé le 29 décembre 2020]. Il est incomplet et la date de fin estimée est le 21 février 2023. Le CDC déclare:

Aucun résultat d’étude publié

Astrazeneca est à des années de la communication des «données finales». Il est impossible pour le ministère britannique de la Santé de l’ examiner , car il n’existe pas.

NCT04516746 est l’un des quatre essais d’AZD1222. Une autre branche russe de l’ essai AZD1222 a été suspendue à la suite d’un événement de réaction indésirable grave inattendue suspectée (SUSAR). Le SUSAR aurait eu lieu au Royaume-Uni après qu’une femme de 37 ans ait développé une inflammation de la moelle épinière. Il semble que le ministère russe de la Santé n’ait pas encore rétabli son bras de l’essai Astrazeneca / Oxford alors qu’il a repris au Royaume-Uni et ailleurs.

Essai clinique NCT04516746: [Archivé le 29.12.2020] , [Lien contemporain]

QUELS ESSAIS DE vakx1?

Le 18 novembre, Pfizer et BioNTech ont annoncé avoir conclu leur essai de phase trois du BNT. Ils avaient démontré une efficacité de 95% et le jalon des données de sécurité de l’ autorisation d’utilisation d’urgence (EUA) de la Food and Drug Administration des États-Unis (FDA) avait été atteint.

La seule partie de cette affirmation qui était vraie était le respect des jalons des données de sécurité d’urgence de la FDA. Ils n’ont pas terminé leurs essais de phase trois. Ils n’ont même pas complètement terminé la première phase.

En vertu de l’article 564 de la loi fédérale sur les aliments, les médicaments et les cosmétiques (FD&C Act ), les médicaments dits «non approuvés» sont autorisés sur le marché en cas d’urgence . De même, au Royaume-Uni, l’autorisation en vertu du règlement 174 du règlement sur la médecine humaine de 2012 (tel que modifié) le permet.

Ayant également été approuvé au Royaume-Uni, c’est pourquoi l’Agence de réglementation des médicaments et des produits de santé (MHRA) déclare:

Ce médicament n’a pas d’autorisation de mise sur le marché au Royaume-Uni

Le fait qu’il n’y ait pas d’essais cliniques terminés pour le vakx1 Pfizer et BioNTech BNT explique également pourquoi la FDA déclare :

Des effets indésirables supplémentaires, dont certains peuvent être graves, peuvent se manifester avec une utilisation plus répandue du vakx1 Pfizer-BioNTech COVID-19.

La FDA a également noté :

[Il y a]… actuellement des données insuffisantes pour tirer des conclusions sur l’innocuité du vakx1 dans des sous-populations telles que les enfants de moins de 16 ans, les femmes enceintes et allaitantes et les personnes immunodéprimées… .. [le] risque de vakx renforcée la maladie au fil du temps, potentiellement associée à une immunité décroissante, reste inconnue.

Pourtant, les premières personnes à recevoir ce vakx1 sont les plus vulnérables de la société, dont beaucoup sont immunodéprimées. Le principe de précaution semble avoir été abandonné. L’idée que le but du déploiement du vakx1 BNT est de sauver des vies semble intenable.

L’annonce de Pfizer a permis aux politiciens de faire semblant de pleurer à la télévision nationale alors que d’autres étaient vraiment excités. Le Premier ministre britannique Boris Johnson a déclaré que c’était «une nouvelle fantastique», et la BBC a déclaré que c’était «une bonne nouvelle» et «vraiment encourageante». Tout le monde a été très impressionné par l’allégation efficace à 95%.

Cependant, cela était basé sur la réduction du risque relatif . C’est la différence en pourcentage déclarée entre la chance de 8/18310 du groupe vakxiné (0,044%) de développer COVID 19 contre une chance de 162/18319 (0,88%) de symptômes de COVID 19 sans le vakx1. Comme ce groupe plus large de 43 000 personnes n’a pas encore été testé, il n’y a aucune base pour ce résultat revendiqué. Mais c’est ce que c’est, et nous pouvons utiliser ces chiffres rapportés ici.

Il convient de noter que cela ne fait référence qu’à une prétendue réduction des symptômes du COVID 19 chez les personnes atteintes du virus. Les paramètres testés ne démontrent pas que le vakx1 réduira la propagation de l’infection ou sauvera des vies. Il convient également de noter que ces chiffres suggèrent que la menace du COVID 19 est extrêmement faible.

En utilisant les chiffres de Pfizer, la réduction du risque relatif est de 100 (1 – (0,044 / 0,88)). Ce qui est de 95%. Voila!

Cela semble fantastique et constitue une bien meilleure stratégie marketing que de signaler la réduction absolue du risque. Le risque absolu de développer les symptômes du COVID 19 sans le vakx1 est supposé de 0,88% et avec le vakx1 de 0,044%. En termes absolus, l’efficacité du vakx1 est de (0,88-0,044)%.

Une réduction du risque de 0,84%. Oh! Une «efficacité» à peine perceptible .

En utilisant la réduction du risque relatif au lieu de l’absolu, les médias grand public (HSH) étaient libres de commercialiser le vakx1 ARNm pour Pfizer et BioNTech (et d’autres parties intéressées) avec des affirmations impressionnantes . Celles-ci n’étaient pas véridiques à distance, non seulement parce qu’elles reposaient sur une manipulation statistique, mais parce que personne n’avait la moindre idée de l’innocuité ou de l’efficacité du BNT. À ce jour, il n’y a pas de résultats d’essais cliniques.

LES ESSAIS CLINIQUES QUI N’EXISTENT PAS

Une analyse des tests RT-PCR positifs disponibles et des résultats de mortalité a conduit l’ Oxford Center for Evidence Based Medicine a estimé un taux de létalité des cas COVID 19 (CFR) très provisoire d’environ 1,4%. Sur la base des chiffres rapportés à la FDA par Pfizer et BioNTech, cela indique un risque de mortalité largement basé sur la population du COVID 19 de 1,4 (0,88 / 100) qui est de 0,012%.

Veuillez garder ce risque incroyablement éloigné à l’esprit lorsque nous discutons de l’indication précoce de la menace apparente pour la santé publique présentée par le vakx1 à ARNm.

Il est raisonnable de travailler en termes de risque de population car, alors que le risque de mortalité par COVID 19 augmente apparemment avec l’âge, l’âge moyen du décès étant de 82 ans et une distribution de la mortalité impossible à distinguer de la mortalité standard, l’intention est de donner le vakx1 à tout le monde .

Si nous regardons la «Surveillance active V-Safe pour les vakx1s COVID 19» rapportée par le Center for Disease Control (CDC) des États-Unis , les premières indications des «événements d’impact sur la santé» (HIE) enregistrés révèlent un niveau inquiétant de réactions indésirables du Vaccin à ARNm. Le CDC définit un HIE comme:

Incapable d’accomplir ses activités quotidiennes normales, incapable de travailler, soins requis par un médecin ou un professionnel de la santé

En Décembre le 18 112,807 personnes ont été injectées avec le vakx1 Pfizer / BionTech aux États – Unis Parmi ceux – ci, 3150 ont ensuite été incapables d’effectuer des activités quotidiennes normales, incapable de travailler, les soins requis du médecin ou professionnel de la santé . Il s’agit d’un taux HIE de 2,8%.

Cela suggère que parmi les 10 premiers millions de personnes à recevoir le vakx1 au Royaume-Uni, environ 280 000 peuvent se trouver incapables d’accomplir leurs activités quotidiennes normales, incapables de travailler et nécessitent des soins médicaux en conséquence. Comme ce sont les plus vulnérables qui sont les premiers à recevoir ce vaccin, étant donné le faible risque de mortalité dû à la maladie COVID 19, il n’est en aucun cas clair qu’il s’agit d’un risque à prendre.

Présentation du CDC: [Archivé le 19.12.2020] , [Original]

Non pas qu’aucun des autres vakx1 semble meilleur. Jusqu’à présent, les CDC ont noté plus de 5 000 HIE pour tous les vakx1 testés sur la population. De toute évidence, il est possible que les vakx1 contribuent à plus de décès que la maladie contre laquelle ils prétendument protéger les personnes vulnérables.

L’essai Pfizer / BioNTech a été enregistré sous le numéro d’essai clinique NCT04368728 auprès du CDC. Ayant récemment discuté de ce que je suis sur le point de partager avec vous avec des personnes qui ont simplement refusé de croire aux preuves de leurs propres yeux, je pense qu’il est important de souligner qu’il s’agit de l’essai clinique de phase 3 que Pfizer a affirmé avoir conclu dans son communiqué de presse. . Il n’y en a pas d’autre. Ça y est .

L’état CDC:

Lorsqu’elles sont disponibles, les informations sur les résultats de l’étude sont incluses dans le dossier de l’étude sous l’onglet Résultats de l’étude ……. Une fois que les informations sur les résultats de l’étude ont été soumises à ClinicalTrials.gov, mais avant d’être publiées, l’onglet des résultats dans le dossier de l’étude est intitulé «Résultats soumis .

Au moment de la rédaction de cet article (21 décembre 2020), comme l’ indique la date de la page Web archivée ClinicalTrials.gov , l’onglet Résultats de l’étude indique «Aucun résultat publié». C’est parce qu’il n’y a pas de résultats publiés ou soumis de l’essai Pfizer BioNTech du vakx1 BNT162b2:

Aucun résultat d’étude publié sur ClinicalTrials.gov pour cette étude

Les rapports des grands médias , donnant l’impression que ces vakx1 se sont avérés efficaces et sûrs, ne sont pas des preuves et ils ne sont pas basés sur la science. Ils sont basés sur une politique politique et rapportent de dangereux bavardages pseudo-scientifiques, déguisés en journalisme scientifique .Il y aura bien sûr des anti-rationalistes insensés qui qualifieront ce dangereux antivaxxer d’absurdité. Insistant constamment sur le fait qu’il est parfaitement sûr de donner un vakx1 avec un profil d’innocuité discutable, pour lequel il n’y a pas d’essais cliniques terminés, aux personnes les plus vulnérables de notre société.

Je manque de patience avec ces gens.

SÉCURITÉ DES vakx1?

La date de début de NCT04368728 était le 29 avril et la date estimée d’achèvement de l’essai est le 27 janvier 2023. La date de fin estimée du premier ou de la phase un d’un essai en trois phases est le 13 juin 2021.

Selon les « mesures actuelles du critère de jugement principal», le délai minimum pour que Pfizer évalue les événements indésirables graves (EIG) est «6 mois après la dernière dose». Il s’agit de la durée minimale pour évaluer les EIG dans la première phase de l’essai.

La phase un est la seule partie de l’essai NCT04368728 à avoir été achevée et publiée . Il a été publié le 14 octobre, 5 mois et 2 semaines après la date de début. La majeure partie de cette période a été consacrée au recrutement et à l’allocation. La durée minimale d’évaluation des EIG n’a pas été respectée au cours de la première phase.

Au cours de la première phase, 195 participants ont été répartis en 13 groupes de 15 personnes. Dans chaque groupe, 12 ont reçu l’un des deux candidats vakxinaux ARNm potentiels (soit BNT162b1 ou BNT162b2) et 3 un placebo.

39 personnes âgées de 18 à 55 ans et 39 autres personnes âgées de 65 à 85 ans ont reçu le vakx1 BNT, désormais approuvé pour une distribution mondiale. La menace du COVID 19, bien que minime dans l’ensemble, est statistiquement nulle pour les 18 à 55 ans. Ceux qui présentaient un risque mesurable de COVID 19 appartenaient au groupe plus âgé.Sur les 39 personnes âgées qui ont reçu 2 doses de BNT, environ la moitié ont éprouvé de la «fatigue», environ 15% avaient des «frissons» et 3 avaient de la fièvre. Les effets secondaires courants de la BNT comprenaient des nausées, des maux de tête (un trouble du système nerveux induit par la BNT très fréquent), une arthralgie et une myalgie (très fréquents), de la fatigue, des frissons et de la fièvre (encore une fois très fréquents). ces problèmes.

Innocuité et immunogénicité de deux candidats vakx1 Covid-19 à base d’ARN: Figure 3, «Participants de 65 à 85 ans» [Archivé le 29.10.2020] , [Original]

L’étude déclare:

Pfizer était responsable de la conception de l’essai; pour la collecte, l’analyse et l’interprétation des données; et pour la rédaction du rapport.

Par conséquent, il est raisonnable de conclure que si Pfizer considère les effets secondaires de son vakx1 comme de la fatigue, des frissons et de la fièvre, les CDC les désignent comme des personnes qui ne peuvent pas travailler et qui ont besoin de soins médicaux.

L’Agence britannique de réglementation des produits médicaux et de santé (MHRA) a approuvé le vakx1 BNT, à administrer aux Britanniques vulnérables, sur la base d’une étude portant sur 39 personnes âgées. Cette étude a rapporté un taux de réactions indésirables assez élevé. Il a été produit exclusivement à partir de la R&D du fabricant du vakx1. Le MHRA n’a rien remis en question.

Ils ont «approuvé» le BNT en sachant qu’il n’y avait pas d’essais cliniques terminés pour ce vakx1. Dans leur rapport public d’évaluation, ils déclarent:

Au moment de la rédaction de cet article, la principale étude clinique est toujours en cours… .Il a été conclu que BNT162b2 s’est avéré efficace dans la prévention du COVID-19. De plus, les effets secondaires observés avec l’utilisation de ce vakx1 sont considérés comme similaires à ceux observés avec d’autres vakx1. Par conséquent, la MHRA a conclu que les avantages sont supérieurs aux risques.

Cette conclusion et cette approbation manquent non seulement de preuves à l’appui, mais sont totalement en contradiction avec ce que l’on sait peu de choses sur la BNT. Alors que Pfizer et BioNTech n’ont terminé les essais du vakx1 que sur 39 sujets de test pertinents, les résultats, même de cet effort pratiquement insignifiant, suggèrent que le risque du vakx1 est plus grand que le risque présenté par COVID 19. Dans une marge considérable.

Cela explique sans aucun doute pourquoi la MHRA a commandé des logiciels à des fournisseurs européens pour faire face à la multitude de réactions indésirables aux vakx1 qu’ils anticipent vraisemblablement. Ils ont déclaré:

La MHRA recherche d’urgence un outil logiciel d’intelligence artificielle (IA) pour traiter le volume élevé attendu de réactions indésirables aux médicaments (EI) du vakx1 Covid-19 … il n’est pas possible de moderniser les systèmes existants de la MHRA pour gérer le volume d’EIM généré par un vakx1 Covid-19.

De la façon dont les fabricants, les politiciens, les régulateurs et les HSH ont abordé la sécurité des vakx1, il est clair qu’ils ont collectivement un mépris total pour le bien-être des personnes vulnérables. Nous devons vraiment mettre de côté cette notion infantile selon laquelle «les autorités» se soucient de nous ou de nos proches. Nous ne signifions rien pour eux.

COVID 19 n’est qu’un risque appréciable pour les plus vulnérables de la société. Il s’agit d’un risque pour les personnes âgées infirmes et les personnes atteintes de maladies potentiellement mortelles.

Si nous regardons les critères d’exclusion de la phase un, ces personnes ne faisaient pas partie de la cohorte testée. Toute personne souffrant d’hypertension artérielle, d’asthme, de diabète ou d’un IMC élevé a été exclue de l’essai d’innocuité présumé. Mais le vakx1 est d’abord administré aux plus vulnérables.

Sur les 39 personnes âgées les plus à risque dans l’étude de phase 1, aucune d’entre elles n’avait les comorbidités graves que possède l’écrasante majorité de ceux qui meurent «avec» le COVID 19. Les personnes réellement à risque de COVID 19 ont nominalement participé aux essais BNT aux phases 2 et 3. Cependant, il semble que tous les efforts aient été faits pour limiter, voire supprimer complètement, leur nombre également. «Les personnes immunodéprimées ou présentant un déficit immunitaire connu ou suspecté» ont été exclues.

L’immunodéficience est causée par un large éventail de problèmes de santé . Des conditions telles que la dénutrition, le polytraumatisme, le stress après une chirurgie, le diabète et le cancer entraînent une immunodéficience. Les personnes présentant les comorbidités associées aux décès dits COVID 19 ont été pratiquement exclues des essais de vakx1 BNT.

NCT04368728 a été conçu comme un essai 1,2,3 avec toutes les phases exécutées simultanément. En ce qui concerne l’évaluation de la sécurité, Pfizer a décrit les événements systémiques comme:

Fièvre, fatigue, maux de tête, frissons, vomissements, diarrhée, douleurs musculaires nouvelles ou aggravées, et douleurs articulaires nouvelles ou aggravées, telles qu’auto-déclarées dans les journaux électroniques.

Les 360 premiers sujets randomisés dans les essais de phase 2 et 3 ont fait l’objet d’une surveillance des événements systémiques pendant moins d’une semaine, après chaque dose:

Dans les 360 premiers participants randomisés en Phase 2/3, pourcentage de participants signalant des événements systémiques [Période: pendant 7 jours après la dose 1 et la dose 2]

La même cohorte de 360 ​​sujets testés a également été suivie pour les événements indésirables graves (EIG) pendant jusqu’à 6 mois en phase 2 et 3:

Dans les 360 premiers participants randomisés en Phase 2/3, pourcentage de participants signalant des événements indésirables graves [Période: de la dose 1 à 6 mois après la dernière dose]

Pfizer a également l’intention de rapporter le pourcentage de tous les sujets de test qui souffrent d’EIG:

Pourcentage de participants à la phase 2/3 signalant des événements indésirables [Période: de la dose 1 à 6 mois après la dernière dose]

Mais il n’y a pas de résultats rapportés de la phase 2 ou 3. Personne n’a la moindre idée des risques pour la santé du BNT, en particulier pour ceux qu’il est censé protéger, et personne en autorité ne s’en soucie. Les essais cliniques de phase 2/3 sont de toute façon discutables.

Les agences de réglementation ont déjà approuvé le vakx1 et les services de santé ont commencé à injecter du BNT aux personnes. Ils le font après que les fabricants n’ont pas réussi à tester correctement sa sécurité sur 39 personnes qui faisaient partie du groupe à risque mais qui n’avaient pas la comorbidité qui a conduit à des décès par COVID 19.

Le degré auquel les gens ont été induits en erreur en leur faisant croire que ces vakx1 sont connus pour être sûrs ou efficaces dépasse presque toute imagination.

Malheureusement, nous n’avons pas besoin d’imagination. La preuve est claire.

***

Vous pouvez en savoir plus sur le travail de Iain sur son blog In This Together

Mise à jour des données scientifiques récentes concernant la politique C0VlD-19

Pour ceux qui ont besoin d’arguments scientifiques sérieux et crédibles

Les mesures de confinement n’empêchent pas les décès, la transmission ne se fait pas par contact, les masques n’apportent aucun bénéfice, les vakx1s sont intrinsèquement dangereux.


Par Denis G. Rancourt – Le 28 décembre 2020 – Source Research Gate

Denis Rancourt.JPG

Les mesures sans précédent de confinement universel, de confinement institutionnel strict des maisons de soins, de masquage universel de la population, d’obsession hygiénique des surfaces et des mains et de déploiement accéléré des vakx1s sont contraires à la science connue et aux récentes études de référence. Le gouvernement a fait preuve d’imprudence par action et de négligence par omission. Des mesures institutionnelles sont nécessaires depuis longtemps pour endiguer la corruption dans le domaine de la médecine et de la politique de santé publique.

  • Contenu de l’article complet à consulter sur le Saker Francophone:
    • Introduction – Pandémie iatrogène de panique
    • La rigueur des mesures n’a aucun effet sur le nombre total de décès attribués à la COVID-19
    • La corruption de la science est mise à nue – Masques et PCR
    • La transmission ne se fait pas par contact
    • Le port du masque dans la population générale n’apporte aucun bénéfice détectable
    • Les vakx1 sont intrinsèquement dangereux

Denis Rancourt, Chercheur, Association des libertés civiles de l’Ontario

L’auteur présente ci dessous ses compétences pour examiner les données scientifiques sur la COVID-19

Je suis retraité et ancien professeur titulaire de physique à l’université d’Ottawa. Le poste de professeur titulaire est le plus haut grade universitaire. Au cours de mes 23 ans de carrière en tant que professeur d’université, j’ai développé de nouveaux cours et j’ai enseigné à plus de 2000 étudiants universitaires, à tous les niveaux, et dans trois facultés différentes (sciences, ingénierie, arts). J’ai supervisé plus de 80 stages de recherche ou diplômes à tous les niveaux, du post-doctorant aux étudiants de troisième cycle en passant par les chercheurs de premier cycle du CRSNG. J’ai dirigé un laboratoire de recherche interdisciplinaire de renommée internationale, et j’ai attiré d’importants fonds de recherche pendant deux décennies.

J’ai été invité une quarantaine de fois à participer à des conférences scientifiques majeures, que ce soit en séance plénière, en tant que conférencier principal ou en session spéciale. J’ai publié plus de 100 articles de recherche dans des revues scientifiques de premier plan évaluées par des pairs, dans les domaines de la physique, de la chimie, de la géologie, de la bio-géochimie, de la science des mesures, de la science du sol et de la science environnementale.

Mon facteur d’impact de l’indice H scientifique est de 40, et mes articles ont été cités plus de 5 000 fois dans des revues scientifiques à comité de lecture (profil sur Google Scholar).

Mes connaissances personnelles et ma capacité à évaluer les faits présentés dans cet article sont fondées sur mon éducation, ma recherche, ma formation et mon expérience, comme suit :

  1. En ce qui concerne les nanoparticules environnementales. Les maladies respiratoires virales sont transmises par la plus petite fraction de taille des particules d’aérosols chargées de virions, qui sont des nanoparticules environnementales réactives. Par conséquent, les stabilités chimiques et physiques et les propriétés de transport de ces particules d’aérosol sont à la base du mécanisme dominant de contagion par l’air. Mes travaux approfondis sur les nanoparticules environnementales réactives sont reconnus au niveau international et portent sur les aspects suivants : précipitation et croissance, réactivité de surface, agglomération, charge de surface, transformation de phase, décantation et sédimentation, et dissolution réactive. En outre, j’ai enseigné la dynamique des fluides (l’air est un fluide compressible) et la sédimentation gravitationnelle au niveau universitaire, et j’ai effectué des recherches sur les applications industrielles de la technologie de filtration (les masques faciaux sont des filtres).
  2. En ce qui concerne la science moléculaire, la dynamique moléculaire et la complexation de surface. Je suis un expert en structures, réactions et dynamiques moléculaires, y compris la complexation moléculaire des surfaces biotiques et abiotiques. Ces processus sont à la base de la fixation des virus, de la fixation des antigènes, de la réplication moléculaire, de la fixation aux fibres des masques, de la charge des particules, de la perte et de la croissance des particules d’aérosol, et de tous ces phénomènes impliqués dans la transmission et l’infection virale, et dans les mesures de protection. J’ai enseigné pendant de nombreuses années la mécanique quantique au niveau universitaire avancé, qui est la théorie fondamentale des atomes, des molécules et des substances ; et dans mes recherches publiées, j’ai développé la théorie et la méthodologie de la diffraction des rayons X pour la caractérisation des petites particules de matériaux.
  3. En ce qui concerne les méthodes d’analyse statistique. L’analyse statistique des études scientifiques, y compris l’analyse robuste de la propagation des erreurs et les estimations robustes des biais, fixe la limite de ce qui peut être déduit de manière fiable de toute étude d’observation, y compris les essais contrôlés randomisés en médecine, et y compris les mesures sur le terrain pendant les épidémies. Je suis un expert en analyse d’erreurs et en analyse statistique de données complexes, au niveau de la recherche dans de nombreux domaines scientifiques. Les méthodes d’analyse statistique sont à la base de la recherche médicale.
  4. En ce qui concerne la modélisation mathématique. Une grande partie de l’épidémiologie est basée sur des modèles mathématiques de transmission et d’évolution des maladies dans la population. J’ai des connaissances et une expérience au niveau de la recherche en matière de modèles mathématiques prédictifs et exploratoires et de méthodes de simulation. J’ai des connaissances d’expert liées aux incertitudes des paramètres et aux dépendances des paramètres dans ces modèles. J’ai réalisé des simulations approfondies de la dynamique épidémiologique, en utilisant des modèles compartimentaux standard (SIR, MSIR) et de nouveaux modèles.
  5. En ce qui concerne les méthodes de mesure. En science, il existe cinq grandes catégories de méthodes de mesure : (1) la spectroscopie (y compris la spectroscopie nucléaire, électronique et vibratoire), (2) l’imagerie (y compris la microscopie optique et électronique, et l’imagerie par résonance), (3) la diffraction (y compris la diffraction des rayons X et des neutrons, utilisée pour élaborer des structures moléculaires, des défauts et des structures magnétiques), (4) les mesures de transport (y compris les taux de réaction, les transferts d’énergie et les conductivités), et (5) les mesures des propriétés physiques (y compris la densité spécifique, les capacités thermiques, la réponse aux contraintes, la fatigue des matériaux…). J’ai enseigné ces méthodes de mesure dans un cours interdisciplinaire de troisième cycle que j’ai développé et donné à des étudiants de troisième cycle (M.Sc. et Ph.D.) en physique, biologie, chimie, géologie et ingénierie pendant de nombreuses années. J’ai fait des découvertes et des progrès fondamentaux dans les domaines de la spectroscopie, de la diffraction, de la magnétométrie et de la microscopie, qui ont été publiés dans des revues scientifiques de premier plan et présentés lors de conférences internationales. Je connais la science des mesures, la base de toutes les sciences, au plus haut niveau.

La vakxination antigrippale depuis le 13 octobre 2020 est-elle responsable de la surmortalité observée en France entre le 15 et le 30 novembre 2020 et dans le reste de l’Europe ?

 Publié dans France Soir le 17/12/2020 à 10:04

Auteur(s): Un citoyen éclairé pour FranceSoir

La vakxination antigrippale depuis le 13 octobre 2020 est-elle responsable de la surmortalité observée en France entre le 15 et le 30 novembre 2020 et dans le reste de l’Europe ?

Résumé :

L’objectif de cette étude est de comprendre pourquoi nous observons une sensible surmortalité imputée au SARS-CoV-2 depuis le 20 octobre alors que l’existence d’une deuxième épidémie d’un même virus respiratoire ne présente aucun antécédent depuis l’ère moderne. Si nous connaissons les infections saisonnières dues à des mutations virales1, le cas d’une deuxième épidémie de SARS-CoV-2 paraît étrange, et cela d’autant plus qu’au premier octobre le taux de reproduction « R0 » était de 1, ne permettant plus une envolée épidémique. En revanche, un facteur coïncide avec l’augmentation nette des hospitalisations et des décès imputés au SARS-CoV-2 depuis le 20 octobre en France. Il s’agit du début de la campagne de vakxination antigrippale démarrée le 13 octobre, pour laquelle 5,3 millions de doses furent vendues en 8 jours, provoquant une rupture de stock sans précédent historique.

Notre réflexion, sur la base de la littérature scientifique et immunologique et d’études récentes concernant l’interaction négative entre vaccin antigrippal et SARS-CoV-2, nous amène à interpeller citoyens et autorités publiques sur le risque d’une potentialisation des effets du SARS-CoV-2 en cas de vakxination antigrippale. De nombreux signaux doivent nous inciter à prendre des précautions.

Les  maladies  automno-hivernales  :  rhinopharyngite,  otite,  bronchiolite,  infection  pulmonaire,  grippe,  gastro-entérite…

Lire la suite de l’article sur le site de France Soir

Conclusion de l’article :

L’objectif de cet article à vocation scientifique est d’interpeller les citoyens et les autorités publiques sur une très probable interaction négative entre vakxination antigrippale, mesures sanitaires excessives et risque de déclarer voire de décéder d’une infection par le SARS-CoV-2. Devant la mise en place de principes de précaution sanitaires qui apparaissent disproportionnés tels que le port du masque en population générale et en extérieur, mesure dont aucune étude n’a pu démontrer l’utilité43, ou encore le confinement, comment ne pas appliquer ce principe de précaution concernant le risque d’interaction négative entre la vakxination de masse antigrippale et le Covid-19 ? Ce deux poids, deux mesures n’est justifié par aucune raison solide. Nous osons dire que la campagne de vakxination massive contre la grippe cette année aura plutôt servi les intérêts opportunistes de Sanofi et de tous les industriels de la vakxination en dépit du bon sens et de la santé des citoyens.

Les citoyens doivent être informés de ces études et observations avant de procéder à une vakxination antigrippale , ou de tout autre vakx1, dont les effets secondaires sont systématiquement minorés par les autorités.

P.S de l’auteur :

Cet article a été rédigé par un citoyen de formation scientifique, libre et éclairé sur le sujet. L’auteur n’a aucun conflit d’intérêts puisqu’il ne travaille pas avec l’industrie pharmaceutique. D’autre part, l’auteur estime ne pas souffrir de conflit cognitif et égotique quant à la compréhension et l’analyse du sujet. Le conflit d’ordre cognitif semble être un frein majeur pour s’exprimer sur le sujet avec justesse et objectivité. En effet, il est très difficile pour un médecin ou un personne qui travaille dans le domaine de la santé, de remettre en question les connaissances qu’il a durement acquises au cours d’un cursus scolaire et universitaire, qui l’ont conforté dans son statut social. Ce phénomène est naturel, et rend les prises de positions bien plus délicate que les conflit d’intérêt, en effet la plupart des personnes qui travaillent avec l’industrie pharmaceutique sont sincères et s’appuient sur un corpus de connaissance qu’elles ne peuvent remettre en cause facilement.

La réflexion est appuyée par des faits, des publications scientifiques et de nombreux ouvrages écrits par des professionnels qui ont étudié l’immunologie et la vakxination en toute objectivité et sans conflits d’intérêts. Michel de Lorgeril, Michel Georget, pour ne citer qu’eux.

Plusieurs spécialistes se sont déjà interrogés sur la question soulever ici.

Le Dr. Michel de Lorgeril, sur son blog, dans deux articles, le 30 octobre et le 12 novembre, Le Dr. Louis Fouché au micro d’Exuvie TV le 26 novembre, Le microbiologiste Claude Escarguel au micro de FranceSoir le 28 novembre

Le virus existe-t-il ? La question mérite d’être posée.

Avez-vous entendu parler de la théorie émergente sur la nature des virus : les exosomes ?
Avez-vous entendu aussi parler des études d’Antoine Béchamp (concurrent de Pasteur) sur le microzymas ?
Êtes-vous absolument certain que le COVID-19 est contagieux ?
Quel est votre niveau de confiance dans les résultats du test ?

Ci-dessous un petit résumé (executive summary) de l’article téléchargeable (en anglais) de David Crowe (décédé en 2020) et ici le lien vers le site où il préparait un livre à ce sujet).

Et avant cela une petite vidéo sur les exosomes (sous-titres français).

https://odysee.com/@Eveilinfo:b/virus-vs-exosomes-test-pcr:a

Résumé de l’article traduit en français

Le monde souffre d’une énorme illusion basée sur la croyance qu’un test de RNA est un test pour un nouveau virus mortel, un virus qui a émergé de chauves-souris sauvages ou d’autres animaux en Chine, appuyés par l’hypothèse occidentale selon laquelle les Chinois mangera tout ce qui bouge.
Si le virus existe, il devrait être possible de purifier les particules virales. De ces particules l’ARN peut être extrait et doit correspondre à l’ARN utilisé dans ce test. Dans ce qui est fait, il est possible que l’ARN provienne d’une autre source, qui pourrait être les cellules du patient, bactéries, champignons, etc.
Il peut y avoir une association avec une niveaux de cet ARN et de la maladie, mais ce n’est pas la preuve que l’ARN provient d’un virus.
Sans purification et caractérisation des particules virales, il ne peut être accepté qu’un test d’ARN soit la preuve qu’un virus est présent. Les définitions des maladies importantes sont étonnamment vagues, peut-être embarrassantes. Quelques symptômes, peut-être un contact avec un patient précédent, et un test de une précision inconnue, c’est tout ce dont vous avez souvent besoin. Alors que la définition du SRAS, provenant d’une ancienne panique du coronavirus, est auto-limitante, la définition de la maladie COVID-19 est ouverte, permettant à l’épidémie imaginaire de se développer.

Mettant de côté l’existence du virus, si le test COVID-19 a un problème avec les faux positifs (comme le font tous les tests biologiques) alors tester une population non infectée ne produira que des tests faussement positifs, et la définition de la maladie permettra à l’épidémie de durer indéfiniment.
Cette nouvelle maladie étrange, officiellement nommée COVID-19, n’a aucun de symptômes propres . Fièvre et toux, précédemment attribuées à d’innombrables virus et bactéries, ainsi que les contaminants environnementaux, sont les plus courants, ainsi que les images pulmonaires anormales, malgré celles qui se trouvent chez des personnes en bonne santé.

Pourtant, malgré le fait que seule une minorité de personnes testées sera positive (souvent moins de 5%), on suppose que cette maladie est facilement reconnaissable. Si c’était vraiment le cas, la majorité des gens sélectionnés pour les tests par les médecins devraient être positifs. Le test COVID-19 est basé sur la PCR, une technique de fabrication d’ADN. Lorsqu’il est utilisé pour tester il ne produit pas un résultat positif / négatif, mais simplement le nombre de cycles nécessaire pour détecter suffisamment de matériau pour passer le seuil arbitraire entre le positif et négatif. Si positif signifie infecté et négatif signifie non infecté, alors il y a des cas de personnes qui passent d’infectées à non infectées et de nouveau à infectées dans les quelques jours suivant.
Beaucoup de gens disent qu’il vaut mieux prévenir que guérir. Mieux vaut que certaines personnes soient mis en quarantaine qui ne sont pas infectés que risquent une pandémie. Mais une fois que les gens sont testés positifs, ils sont susceptibles d’être traités avec des traitements similaires au SRAS. Les médecins face à ce qu’ils croient être un traitement antivirus mortel pour l’avenir, pour les symptômes anticipés, pas pour ce qu’ils voient aujourd’hui. Cela conduit à l’utilisation d’une oxygénation invasive, à forte dose corticostéroïdes, médicaments antiviraux et plus encore. Dans ce cas, certaines populations de diagnostiqués (par exemple en Chine) sont plus âgés et plus malades que la population générale et moins capable de résister à un traitement agressif. Après que la panique du SRAS se soit calmée les médecins ont examiné les preuves et ont montré que ces traitements étaient souvent inefficaces, et tous ont eu des effets secondaires graves, tels qu’un déficit neurologique persistant, arthroplasties, cicatrices, douleurs et maladies du foie. Ainsi qu’une mortalité plus élevée.

L’étude complète en anglais et en PDF

L’étude téléchargeable sur le web

La chaîne d’Angelo Pergola consacrée aux microzymas d’Antoine Béchamp

L’analyse d’un scientifique sur la pseudo science au service de la géo-politique globaliste

Très intéressante interview de M. Denis Rancourt, chercheur et ancien professeur à l’université d’Ottawa. Il y fait état notamment des études véritablement scientifiques sur l’inutilité des mesures de confinement, des masques et des dangers inconnus des vaccins. Il analyse également les raisons géo-politiques de la crise de ce virus. Y sont également évoqué, les études du professeur Cohen sur le rôle du stress sur l’immunité.

Reiner Fuellmich, avocats et médecins contre l’arnaque du Covid-19

A ne pas rater!
Reiner Fuellmich, avocat exerçant en Allemagne et aux Etats-Unis et ayant notamment dirigé l’action contre la fraude des moteurs diesel de Volkswagen et dénonçant les fraudes de grands groupes internationaux comme la Deustche Bank. Il dénonce ici la grande fraude de cette épidémie du C0VlD à travers les faux tests PCR, les faux scientifiques, le vakx1 et les actions de grands groupes internationaux contre les institutions nationales.
Voir aussi la vidéo publiée précédemment sur ce blog et annonçant l’action juridique internationale pour crime contre l’humanité qu’il intente.

https://odysee.com/@JeanneTraduction:a/reiner:9

Add-on: interview de Dr Fuellmich par France Soir ce 21/12/2020

Voir aussi: Allemagne : démission du Pr Aigner, en désaccord avec la science pratiquée

Selon une étude scientifique, le confinement et les mesures sanitaires strictes n’auraient aucun impact sur la mortalité du virus.

L’étude publiée le 19 novembre, sur Frontier in Public Health sur la mortalité du Covid19 dans 188 pays, confirme peut-être ce que beaucoup pensent tout bas : il n’existerait aucun lien entre le confinement, des mesures sanitaires strictes et la mortalité du virus.

Pour arriver à cette conclusion, les chercheurs ont notamment étudié, pour chaque pays :
– l’espérance de vie ;
– le nombre de décès liés au cancer, aux maladies cardiovasculaires, chroniques et infectieuses ;
– les taux d’obésité, d’inactivité et de sédentarité ;
– la richesse économique ;
la sévérité des mesures anti-covid des gouvernements ; 

 Deux types de pays ont alors émergé  :
Les pays dits « riches », avec des taux élevés de maladies chroniques et cardiovasculaires et une population vieillissante et sédentaire : ils se situent en Amérique du Nord, en Europe et dans une partie de l’Asie ;
Les pays moins riches, avec des populations plus jeunes et des taux élevés de maladies infectieuses (dengue, malaria, etc.), plutôt localisés en Afrique, en Amérique du Sud et en Asie du Sud-Est. 

Et voici ce que conclut l’étude : les pays les plus riches ont payé le plus lourd tribut face au virus, sans lien avec la sévérité des mesures imposées.

Dans les pays riches, nous avons tendance à vivre plus longtemps mais aussi à être moins actifs que dans les pays moins développés.
Or, la sédentarité est une cause majeure de comorbidités : hypertension, diabète et troubles cardiovasculaires pour les principales. 

La mortalité élevée du virus dans nos sociétés est donc surtout liée à la vieillesse de la population, et à notre mode de vie.

Et les chiffres donnent raison aux chercheurs :

En France, depuis le 1er mars 2020,
– 91,7 % des décès du Covid avaient plus de 65 ans, avec un âge médian de 84 ans [i] ;
– 65 % des morts du virus souffraient d’une co-morbidité (une hypertension artérielle dans 24 % des cas, une pathologie cardiaque pour 35%) ;
– 44 % de ces décès ont eu lieu en maison de retraite, une proportion atteignant 59 % en Norvège et 72 % en Espagne[iii].

Au 5 novembre 2020, le taux de mortalité était de 0,05 %. Vous aviez donc 1 risque sur 2000 de mourir du virus… et 99,05 de chance d’y survivre!

À titre de comparaison, au cours de sa vie, une personne à 1 risque sur 6 de mourir d’un accident cardiovasculaire. Et cela ne nous empêche pas de vivre !

Le problème, c’est que l’incertitude dans laquelle nous plonge cette pandémie nous fait surestimer les risques.

Et les médias ou le gouvernement en profitent pour imposer des mesures de plus en plus décriées et pesantes pour beaucoup d’entre nous.

Abstract de l’étude:

Contexte

Les territoires de développement humain ont été sévèrement limités par la pandémie Covid-19. Une dynamique commune a été observée, mais sa propagation n’a pas été homogène sur chaque continent. Nous visions à caractériser les paramètres non viraux les plus associés au taux de mortalité.

Méthodes

Nous avons testé les principaux indices de cinq domaines (démographie, santé publique, économie, politique, environnement) et leurs associations potentielles avec la mortalité de Covid-19 au cours des 8 premiers mois de 2020, à travers une analyse en composantes principales et une matrice de corrélation avec un test Pearson de corrélation. Les données de tous les pays ou états des pays fédéraux, indiquant au moins 10 cas de décès, ont été extraites des sites publics officiels. Pour les pays qui n’ont pas encore terminé la première phase épidémique, un modèle prospectif a été calculé pour fournir des options d’évolution des taux de mortalité.

Résultats

Des taux de mortalité Covid plus élevés sont observés dans la latitude [25/65 °] et dans les plages de longitude [−35 / −125 °].
Les critères nationaux les plus associés au taux de mortalité sont l’espérance de vie et son ralentissement, le contexte de santé publique (charge des maladies métaboliques et non transmissibles (MNT) par rapport à la prévalence des maladies infectieuses), l’économie (croissance du produit national, soutien financier) et l’environnement (température , indice ultraviolet).
La rigueur des mesures prises pour lutter contre la pandémie, y compris le verrouillage, ne semble pas liée au taux de mortalité.

Conclusion

Les pays qui ont déjà connu une stagnation ou une régression de l’espérance de vie, avec des revenus élevés et des taux de MNT, avaient le prix le plus élevé à payer. Ce fardeau n’a pas été allégé par des décisions publiques plus strictes.
Des facteurs inhérents ont prédéterminé la mortalité Covid-19: leur compréhension peut améliorer les stratégies de prévention en augmentant la résilience de la population grâce à une meilleure forme physique et une meilleure immunité.

Covid-19: politisation, «corruption» et suppression de la science

Editorial publié dans sa propre revue par Kamran Abbasi, rédacteur en chef de la revue scientifique BMJ (British Medical Journal)

Quand la bonne science est supprimée par le complexe médico-politique, les gens meurent.

Les politiciens et les gouvernements suppriment la science. Ils le font dans l’intérêt public, disent-ils, pour accélérer la disponibilité des diagnostics et des traitements. Ils le font pour soutenir l’innovation, pour mettre des produits sur le marché à une vitesse sans précédent. Ces deux raisons sont en partie plausibles; les plus grandes déceptions sont fondées sur un grain de vérité. Mais le comportement sous-jacent est troublant.

La science est supprimée à des fins politiques et financières. Covid-19 a déclenché la corruption de l’État à grande échelle et est néfaste pour la santé publique.  Les politiciens et l’industrie sont responsables de ce détournement de fonds opportuniste. Il en va de même pour les scientifiques et les experts en santé. La pandémie a révélé comment le complexe médico-politique peut être manipulé en cas d’urgence – un moment où il est encore plus important de sauvegarder la science.

La réponse pandémique du Royaume-Uni fournit au moins quatre exemples de suppression de la science ou des scientifiques.
Premièrement, la composition, la recherche et les délibérations du Groupe consultatif scientifique pour les urgences (SAGE) étaient initialement secrètes jusqu’à ce qu’une fuite de presse force la transparence.  La fuite a révélé l’ interférence des conseillers gouvernementaux dans SAGE, tout en exposant la sous-représentation de la santé publique, les soins cliniques, les femmes et les minorités ethniques. En effet, le gouvernement a également reçu récemment l’ordre de publier un rapport de 2016 sur les lacunes de la préparation à une pandémie, l’opération Cygnus, à la suite d’un verdict du bureau du commissaire à l’information. 

Ensuite, un rapport de Public Health England sur la covid-19 et les inégalités. La publication du rapport a été retardée par le ministère de la Santé d’Angleterre; une section sur les minorités ethniques a été initialement suspendue puis, à la suite d’un tollé général, a été publiée dans le cadre d’un rapport de suivi.  Les auteurs de Public Health England ont reçu pour instruction de ne pas parler aux médias.

Troisièmement, le 15 octobre, le rédacteur en chef du Lancet s’est plaint qu’un auteur d’un article de recherche, un scientifique du gouvernement britannique, a été empêché par le gouvernement de parler aux médias en raison d’un «paysage politique difficile». 

Maintenant, un nouvel exemple concerne la controverse sur les tests d’anticorps au point de service pour la covid-19.  L’opération Moonshot du Premier ministre dépend de la disponibilité immédiate et généralisée de tests de diagnostic rapide précis.  Il dépend aussi de la logique douteuse de dépistage en masse à l’essai à Liverpool avec un suboptimal test PCR. 

L’incident est lié à une recherche publiée cette semaine par le BMJ , qui révèle que le gouvernement a acheté un test d’anticorps qui, dans les tests du monde réel, est bien en deçà des déclarations de performance faites par ses fabricants. Des chercheurs de Public Health England et des institutions collaboratrices ont raisonnablement poussé à publier les résultats de leur étude avant que le gouvernement ne s’engage à acheter un million de ces tests, mais ont été bloqués par le ministère de la Santé et le bureau du Premier ministre.  Pourquoi était-il important de se procurer ce produit sans examen minutieux? La publication préalable de recherches sur un serveur de pré-impression ou sur un site Web gouvernemental est compatible avec le politique de publication de BMJ. Comme pour prouver un point, Public Health England a ensuite tenté en vain de bloquer le communiqué de presse du BMJ concernant le document de recherche.

Les politiciens prétendent souvent suivre la science, mais c’est une simplification excessive trompeuse. La science est rarement absolue. Cela s’applique rarement à tous les milieux ou à toutes les populations. Cela n’a pas de sens de suivre servilement la science ou les preuves. Une meilleure approche consiste pour les politiciens, les décideurs nommés publiquement, à être informés et guidés par la science lorsqu’ils décident des politiques pour leur public. Mais même cette approche ne retient la confiance du public et des professionnels que si la science est disponible pour examen et sans ingérence politique, et si le système est transparent et n’est pas compromis par des conflits d’intérêts.

La répression de la science et des scientifiques n’est ni nouvelle ni un phénomène particulièrement britannique. Aux États-Unis, le gouvernement du président Trump a manipulé la Food and Drug Administration pour approuver à la hâte des médicaments non prouvés tels que l’hydroxychloroquine et le remdesivir. Globalement, les gens, les politiques et les marchés sont corrompus par les agendas politiques et commerciaux. 

La réponse du Royaume-Uni à la pandémie repose trop fortement sur des scientifiques et d’autres personnes nommées par le gouvernement aux intérêts concurrents inquiétants, y compris des participations dans des entreprises qui fabriquent des tests de diagnostic, des traitements et des vaccins covid-19.  nommées par le gouvernement sont en mesure d’ignorer ou de faire des choix scientifiques spécieux une autre forme d’abus et se livrer à des pratiques anticoncurrentielles qui favorisent leurs propres produits et ceux des amis et associés. 

Comment la science pourrait-elle être sauvegardée en ces temps exceptionnels? La première étape est la divulgation complète des intérêts concurrents du gouvernement, des politiciens, des conseillers scientifiques et des personnes nommées, tels que les responsables des tests et du traçage, de l’approvisionnement en tests diagnostiques et de la livraison des vaccins. La prochaine étape est la transparence totale des systèmes de prise de décision, des processus et de savoir qui est responsable de quoi.

Une fois que la transparence et la responsabilité sont établies en tant que normes, les personnes employées par le gouvernement ne devraient idéalement travailler que dans des domaines sans rapport avec leurs intérêts concurrents. L’expertise est possible sans intérêts concurrents. Si une règle aussi stricte devient irréalisable, la bonne pratique minimale est que les personnes ayant des intérêts concurrents ne doivent pas être associées aux décisions relatives aux produits et aux politiques dans lesquelles elles ont un intérêt financier.

Les gouvernements et l’industrie doivent également cesser d’annoncer une politique scientifique critique par communiqué de presse. De telles mesures mal jugées laissent la science, les médias et les marchés boursiers vulnérables à la manipulation. Une publication claire, ouverte et préalable des bases scientifiques de la politique, des achats et des médicaments miracles est une exigence fondamentale. 

Les enjeux sont élevés pour les politiciens, les conseillers scientifiques et les personnes nommées par le gouvernement. Leur carrière et leurs soldes bancaires peuvent dépendre des décisions qu’ils prennent. Mais ils ont une responsabilité et un devoir plus élevés envers le public. La science est un bien public. Il n’est pas nécessaire de le suivre aveuglément, mais il faut en tenir compte de manière équitable. Il est important de noter que la suppression de la science, que ce soit en retardant la publication, en sélectionnant des recherches favorables ou en bâillonnant les scientifiques, est un danger pour la santé publique, causant des décès en exposant les gens à des interventions dangereuses ou inefficaces et en les empêchant de bénéficier de meilleures. Lorsqu’il est mêlé à des décisions commerciales, il s’agit également d’une mauvaise administration de l’argent des contribuables.

La politisation de la science a été déployée avec enthousiasme par certains des pires autocrates et dictateurs de l’histoire, et elle est malheureusement courante dans les démocraties.  Le complexe médico-politique tend vers la suppression de la science pour agrandir et enrichir ceux qui sont au pouvoir. Et, à mesure que les puissants gagnent en succès, s’enrichissent et s’enivrent davantage de pouvoir, les vérités peu pratiques de la science sont supprimées. Lorsque la bonne science est supprimée, les gens meurent.

Lien vers l’article en anglais avec toutes les références

COVID19 – Preuve d’une fraude mondiale !

Lien vers l’article original du site OffGuardian.org avec tous les liens

Iain Davis

Le COVID 19 et les réponses gouvernementales ultérieures semblent faire partie d’un complot international en vue de commettre une fraude. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID 19.

Parfois, vous devez suivre votre instinct. Je ne suis pas un expert en génétique et, comme toujours, je dois être corrigé. Cependant, mon attention a été attirée sur certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur  conseil consultatif, composé  de médecins et de scientifiques éminemment qualifiés, confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction en anglais (voir le précédent article de eveilinfo.org avec la traduction en français )  de leur rapport et je  peux corroborer l’exactitude de leurs affirmations concernant les séquences nucléotidiques répertoriées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire la même chose.

D-Salud-Discovery indique qu’il n’y a pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du COVID 19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de COVID 19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de celui-ci.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve d’une pandémie, simplement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, autre que les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette  «classe de parasites»  a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’enquêtes et de poursuites devant un tribunal.

IDENTIFICATION DE QUOI EXACTEMENT?

L’Organisation mondiale de la santé (OMS) a  classé le COVID-19  (COronaVIrus Disease 2019). Ils ont déclaré une pandémie mondiale de COVID 19 le 11 mars 2019.

Les directives de l’OMS sur les  analyses de laboratoire  stipulent:

L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau bêtacoronavirus, (dans la même famille que le SRAS-CoV et le MERS-CoV) via le séquençage de nouvelle génération (NGS) à partir du virus de culture ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus SRAS-CoV-2  provoque la maladie COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de situation 1 sur le nouveau coronavirus 2019-nCov de l’OMS  , ils déclarent:

Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 …… Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays l’utilisent dans le développement de kits de diagnostic spécifiques.

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour étude), puis des séquences génétiques ont été  identifiées à  partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été développés et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et des chercheurs chinois, ces tests permettront de trouver le virus responsable du COVID 19.

Pourtant, l’OMS déclare également:

Travaillant directement à partir des informations de séquence, l’équipe a développé une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des  «informations de séquence»  car il n’y avait pas d’échantillon isolé et purifié du virus dit SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines hérissée contenant l’ARN viral).

Cependant, ces structures protéiques ne sont  pas uniques . Ils ressemblent à d’autres vésicules rondes, telles que les vésicules endocytaires et les exosomes.

Les virologues affirment qu’il n’est pas possible d ‘  «isoler»  un virus car ils ne se répliquent qu’à l’intérieur des cellules hôtes. Ils ajoutent que  les postulats de Koch  ne s’appliquent pas parce qu’ils concernent des bactéries (qui sont des organismes vivants). Au lieu de cela, les virologues observent les effets cytopathogènes (CPE) du virus, provoquant la mutation et la dégradation des cellules, dans les cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé pour  la première fois le génome complet du SRAS-CoV-2, ils ont observé le CPE dans les cellules Vero E6 et Huh7. Vero E6 est une lignée cellulaire de singe immortalisée et Huh7 sont des cellules cancéreuses immortalisées (tumorigènes). Cela signifie qu’ils ont été maintenus in vitro (dans des cultures de boîtes de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 est l’idée qu’il s’agit d’un virus zoonotique, capable de combler le fossé des espèces entre les animaux et les humains. Lorsque des  scientifiques du CDC américain ont  «infecté»  diverses cellules avec le nouveau virus, ils ont noté ce qui suit:

Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires de primates et humaines communes, y compris les cellules d’adénocarcinome humain (A549) [cellules pulmonaires], les cellules hépatiques humaines (HUH7.0) et les cellules rénales embryonnaires humaines ( HEK-293T), en plus de Vero E6 et Vero CCL81 [cellules de singe]… Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero [cellules de singe]… Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et Les cellules A549 [cellules du tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2. »

Le CDC n’a observé aucun CPE dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, suggérant qu’une infection d’un humain à l’autre serait impossible.

Notant ce problème, une équipe de scientifiques polonais a introduit ce «virus» séquencé   dans  les cellules de l’épithélium humain (voies respiratoires) . Ils ont observé les effets sur ces cultures d’AOH pendant 5 jours. Ils ont noté une réplication beaucoup plus grande que les scientifiques du CDC, mais ont finalement déclaré:

«Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’AOH.»

Cela signifie qu’ils n’ont vu aucune preuve des virions supposés rompant la membrane de la paroi cellulaire. Encore une fois, suggérant que ce soi-disant virus n’est pas infectieux chez l’homme.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer des maladies. Cela peut même ne pas exister physiquement. N’est-ce rien d’autre qu’un concept basé sur   des séquences génétiques prédictives ?

VOYAGE DE DÉCOUVERTE

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2  (MN908947.1). Cela a été mis à jour plusieurs fois. Cependant, MN908947.1 était la première séquence génétique décrivant l’ agent étiologique présumé du COVID 19   (SARS-CoV-2).

Toutes les déclarations, tests, traitements, statistiques, développement de vaccins et politiques qui en résultent sont basés sur cette séquence. Si les tests pour ce  nouveau  virus n’identifient rien de capable de provoquer des maladies chez les êtres humains, tout le récit du COVID 19 n’est rien d’autre qu’une mascarade.

Les  chercheurs de WUHAN ont déclaré  qu’ils avaient effectivement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques, découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé un  assemblage de novo  et une PCR ciblée et ont trouvé 29 891 paires de bases partageant une correspondance de séquence de 79,6% avec le SARS-CoV.

Ils ont dû utiliser l’  assemblage de novo  parce qu’ils n’avaient aucune  connaissance a  priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle des chercheurs chinois ont  isolé  le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome du coronavirus du SRAS publié (SARS-CoV). Malheureusement, la précision du génome original du SRAS-CoV n’est pas non plus claire.

En 2003, une équipe de  chercheurs de Hong Kong a  étudié 50 patients atteints du syndrome respiratoire aigu sévère (SRAS). Ils ont prélevé des échantillons de 2 de ces patients et ont développé une culture dans des cellules hépatiques de singe foetal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques  «d’origine inconnue».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il appartenait à la famille des Coronaviridae. Considérant que ces séquences suggéraient un virus SARS-CoV nouvellement découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré:

Les amorces de détection du nouveau virus ont été conçues pour la détection par RT-PCR de ce génome de coronavirus humain associé à la pneumonie dans des échantillons cliniques. Sur les 44 échantillons de nasopharynx disponibles auprès des 50 patients atteints du SRAS, 22 présentaient des preuves d’ARN de coronavirus humain associé à la pneumonie.

La moitié des patients testés, qui présentaient tous les mêmes symptômes, ont été testés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce  nouveau  virus SRAS-CoV. La question n’a pas été posée.

Ce virus supposé n’avait qu’une correspondance de séquence de 57% avec le coronavirus prétendument connu. Les 43% restants étaient simplement  «là».  Les données séquencées ont été produites et enregistrées en tant que nouveau génome sous le numéro d’ accès GenBank  AY274119 .

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement renommée SARS-CoV-2). Personne, à aucun stade de ce processus, n’avait produit d’échantillon isolé et purifié de quelque virus que ce soit. Tout ce qu’ils avaient était des correspondances de séquence de pourcentage avec d’autres correspondances de séquence de pourcentage.

N’ISOLER RIEN

Les scientifiques sont très ennuyés car ils n’arrêtent pas de dire que le virus a été isolé mais personne ne les croit. C’est parce que, pour l’instant, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images de virions du SRAS-C0V-2 de confirmer qu’il s’agissait d’images d’un virus isolé et purifié. Aucun d’eux ne le pouvait .

En Australie, des scientifiques du  Doherty Institute ont annoncé avoir  isolé  le virus SARS-CoV-2 . Lorsqu’on leur a demandé de clarifier les choses, les scientifiques ont déclaré:

«Nous avons des séquences courtes (ARN) du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic»

Cela explique pourquoi le  gouvernement australien  déclare:

La fiabilité des tests COVID-19 est incertaine en raison de la base de preuves limitée… Il existe des preuves limitées disponibles pour évaluer l’exactitude et l’utilité clinique des tests COVID-19 disponibles.

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a  écrit une lettre  au Premier ministre britannique Boris Johnson dans laquelle ils lui ont demandé de:

Produire des preuves scientifiques examinées par des pairs de manière indépendante prouvant que le virus Covid-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a  adressé une demande d’accès à l’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. À quoi  ils ont répondu :

PHE peut confirmer qu’il ne contient pas d’informations de la manière suggérée par votre demande. « 

La chercheuse canadienne Christine Massey a fait une demande similaire d’accès à l’information, demandant la même chose au gouvernement canadien. À quoi le  gouvernement canadien a répondu :

Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu localiser aucun document répondant à votre demande. »

Aux États-Unis, le panneau de diagnostic RT-PCR du Center for Disease Control (CDC)   indique:

… Aucun isolat viral quantifié du 2019-nCoV n’est actuellement disponible …… .. La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent causal des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur de tout patient déclaré atteint de la maladie du COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou provoque le COVID 19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Voir aussi: Dr. Tom Cowan w/ Jon Rappoport: SARS-CoV-2 Has Never Been Isolated, Is Only an Imaginary or Theoretical Virus, and, Therefore, No Test Can Detect It

TESTER POUR RIEN

L’OMS, et chaque gouvernement, groupe de réflexion, comité directeur des politiques, conseiller scientifique du gouvernement, institutions supranationales et autres qui promeuvent le récit officiel du COVID 19, affirment que le SRAS-CoV-2 cause le COVID 19.

Bien que personne n’ait jamais produit un échantillon de ce supposé virus, le génome présumé du SRAS-CoV-2  a été publié . C’est dans le domaine public.

On dit que les séquences génétiques clés  du génome du SRAS-CoV-2 ont des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour  identifier  la présence du  «virus» . 

  • Ceux-ci incluent:
    • Gène ARN-polymérase (Rd-Rp) – Cela permet à l’ARN du SARS-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales atteintes de COVID 19.
    • Gène S (Orf2) – cette glycoprotéine forme le pic sur la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 sur les cellules, permettant à l’ARN à l’intérieur de l’enveloppe de la protéine du virion (capside) de passer dans la  cellule maintenant  infectée .
    • Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage viral
    • Gène N (Orf9a) – le gène de la nucléocapside qui lie l’ARN dans la formation de la capside

L’OMS tient un  registre accessible au public  des amorces et sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences nucléotidiques spécifiques qui se lient (s’hybrident) aux brins antisens et sens de l’ADNc synthétisé (appelées respectivement amorces sens et inverse).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences nucléotidiques appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Lors de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, la sonde se désintègre en libérant un fluorescent ou un colorant qui peut ensuite être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

L’ outil de recherche d’alignement local de base  (BLAST) est un autre élément accessible au public  . Cela permet à quiconque de comparer les séquences nucléotidiques publiées avec toutes celles stockées par la base de données génétique des National Institutes of Health (NIH) des États-Unis appelée GenBank. Par conséquent, nous pouvons BLASTER les amorces, sondes et séquences de gènes cibles du SRAS-CoV-2 revendiquées.

Les protocoles d’amorces et de sondes sens et inverses de l’OMS pour le génome viral présumé du SRAS-CoV-2 sont basés sur les profils de gènes RdRp, Orf1, N et E. N’importe qui peut les exécuter via BLAST pour voir ce que nous trouvons.

La séquence nucléotidique vitale RdRP, utilisée comme amorce sens est – ATGAGCTTAGTCCTGTTG. Si nous exécutons un nucléotide BLAST, celui-ci est enregistré comme un isolat  complet de SARS-CoV-2  avec une identité de séquence à 100%. De même, la séquence d’amorce du gène E inverse – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui  identifie également  SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences nucléotidiques des génomes microbiens et humains. Si nous recherchons la séquence RdRp SARS-CoV-2, elle révèle 99 chromosomes humains avec une correspondance d’identité de séquence à 100%. L’Orf1ab (gène E) renvoie 90 avec une correspondance d’identité de séquence de 100% avec les chromosomes humains.

Faire de même pour ces séquences avec une recherche microbienne trouve 92 microbes avec une correspondance à 100% avec le gène SARS-CoV-2 E et 100 microbes correspondants, avec une identité de séquence à 100%, avec le gène vital SARS-CoV-2 RdRp.

Chaque fois que nous vérifions les marqueurs génétiques dits uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, censées identifier le SRAS-CoV-2, ne sont pas uniques. Il peut s’agir de n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les  soi- disant  vérificateurs de faits , comme le  projet Health Feedback de Reuters  , ont rapidement rejeté les affirmations de  ceux qui ont remarqué le manque apparent de spécificité dans le génome supposé du SRAS-CoV-2.

En utilisant une multitude d’arguments d’homme de paille comme,  «cette affirmation suggère que chaque test devrait être positif»  (ce qui n’est pas le cas), leur   tentative de  démystification exécute quelque chose comme ceci :

Les amorces sont conçues pour se lier à des séquences nucléotidiques spécifiques qui sont uniques au virus. L’amorce sens peut se lier à un chromosome particulier, mais l’amorce inverse ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. De plus, parce que les amorces sens et pervers enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble délibérément déformer la signification de ces conclusions en transmettant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont  enquêté sur l’épidémiologie  des cas présumés marocains   de SRAS-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de le dire, beaucoup peuvent avoir été positifs pour aucun.

Ceci est entièrement conforme aux  directives de test de l’OMS . Ils déclarent:

«Un diagnostic optimal consiste en un NAAT [test d’amplification d’acide nucléique] avec au moins deux cibles indépendantes du génome du SRAS-CoV-2; cependant, dans les régions où la transmission est répandue, un algorithme simple à cible unique peut être utilisé… Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs de faits bien financés  ,  si les amorces avant et arrière identifient des indésirables, peut-être l’un étant le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée entre eux est probablement également indésirable.

L’argument selon lequel la RT-PCR ne trouve que l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression génique. Personne ne dit que des chromosomes entiers ou des microbes sont séquencés dans le génome présumé du SRAS-CoV-2. Bien qu’ils puissent, pour tout ce que nous savons. Ils disent que les marqueurs présumés, utilisés pour tester ce supposé virus, ne sont pas adaptés.

Les tests RT-PCR ne séquencent pas le génome entier. Ils recherchent des incidents de fluorescence de sonde spécifique pour indiquer la présence de séquences dites exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et sondes ne pouvaient rien révéler d’autre que des correspondances d’ARN extraites d’  ADN non codant, parfois appelé  «indésirable», ADN (ADNc).

Par exemple, le  gène SARS-CoV-2 S  est censé être hautement spécifique du génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité à 100%. La correspondance de pourcentage d’identité la plus faible, parmi les 100 premiers, est de 95%. Un BLAST du génome humain trouve également une correspondance de séquence à 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement ce que c’est. Le génome entier pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve que le SRAS-CoV-2 existe. Par conséquent, il n’y a pas non plus de preuve qu’une maladie appelée COVID 19 existe.

Cela signifie qu’il n’y a aucune base scientifique pour toute allégation concernant le nombre de cas de COVID 19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour  lutter contre  ce  virus mortel  sont très probablement fondées sur rien.

FRAUDE CONCLUANTE

La fraude est un acte criminel. La  définition juridique  de la fraude est:

«Une pratique frauduleuse ou un acte délibéré, auquel on a eu recours avec l’intention de priver un autre de ses droits ou, d’une manière ou d’une autre, de lui causer des blessures.»

La définition légale d’un complot est:

« Une combinaison ou une confédération entre deux ou plusieurs personnes constituées en vue de commettre, par leurs efforts conjoints, un acte illégal ou criminel »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont fourni aucune preuve pour montrer qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID 19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut le lire.

Pour qu’il y ait fraude, la tromperie doit être volontaire. L’intention doit être de priver délibérément autrui de ses droits ou de lui porter atteinte d’une autre manière. S’il existe des preuves de collusion entre des individus et / ou des organisations pour commettre une fraude, il s’agit alors d’un complot (dans les juridictions de common law) ou d’une  entreprise criminelle commune  (ECC) en vertu du droit international.

Il semble que COVID 19 a été délibérément utilisé comme  casus belli  pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté d’errer restreinte, la liberté de parole et d’expression érodée, les droits de manifester restreints, séparés de nos proches, nos entreprises détruites, psychologiquement bombardées, muselées et terrorisées.

Pire encore, bien qu’il n’y ait  aucune preuve  de   mortalité toutes causes sans précédent , il y a eu des pics de décès non saisonniers. Celles-ci  correspondent précisément aux mesures de verrouillage  qui ont vu le retrait des services de santé pour lesquels nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire du COVID 19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’  humanité elle-même .

Pour être  autorisés  à participer à leur soi-disant  «nouvelle normalité»,  qui est la transformation globale de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci incluent, mais sans s’y limiter, la surveillance bio-métrique de tout le monde, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une revendication effective que nous n’avons pas droit à la souveraineté sur nos propres organes. Ceci constitue la  condition de l’esclavage .

Il ne fait aucun doute que nous avons été privés de nos droits et lésés. Dans les juridictions de common law, l’innocence est présumée, mais la preuve qu’un préjudice a été délibérément causé par un complot international est accablante. Les politiques destructrices, adoptées par les gouvernements du monde entier, sont clairement nées des groupes de réflexion mondialistes et des institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont collectivement été incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le COVID 19 est un mythe.

Les responsables du crime de complot en vue de commettre une fraude mondiale devraient être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que nous autres essayons de réparer les dommages qu’ils ont déjà infligés.

Article complémentaire montrant que le virus n’a jamais été isolé.

Encore un article de Réseau International sur le même sujet

Une étude scientifique danoise conclut à l’inefficacité des masques

Voir aussi en bas d’article d’autres sources et une petite vidéo d’Eric Remacle

Il semble que ceci est la première et seule étude scientifique connue concernant l’efficacité des masques dans la transmission du virus SRAS-COV-2. On ne peut pas dire que cela conforte les impositions gouvernementales de port du masque.

L’étude complète en anglais

Résumé traduit en français:

Efficacité d’ajouter une recommandation de port de masque à d’autres mesures de santé publique pour prévenir l’infection par le SRAS-CoV-2 pour des porteurs danois.


Un essai contrôlé randomisé
Henning Bundgaard, DMSc, Johan Skov Bundgaard, BSc, … Voir tous les auteurs
Auteur, article et divulgation d’informations
https://doi.org/10.7326/M20-6817

Contexte :
Les observations courantes suggèrent que le port du masque atténue la transmission du coronavirus 2 du syndrome respiratoire aigu sévère (SRAS-CoV-2). Il n’est pas certain que cette association observée soit due à la protection des porteurs non infectés (effet protecteur), à la réduction de la transmission par les porteurs de masques infectés (contrôle à la source), ou aux deux.

Objectif :
Évaluer si le fait de recommander l’utilisation de masques chirurgicaux en dehors du domicile réduit le risque d’infection par le CoV-2 du SRAS chez les porteurs dans un contexte où les masques étaient peu courants et ne faisaient pas partie des mesures de santé publique recommandées.

Conception :
Essai contrôlé randomisé (DANMASK-19 [étude danoise pour évaluer les masques de protection contre l’infection par COVID-19]). (ClinicalTrials.gov : NCT04337541)

Le réglage :
Danemark, avril et mai 2020.

Participants :
Adultes passant plus de 3 heures par jour en dehors de la maison sans utiliser de masque professionnel.

Intervention :
Encouragement à suivre les mesures de distanciation sociale pour la maladie à coronavirus 2019, plus soit une recommandation de ne pas porter de masque, soit une recommandation de porter un masque en dehors de la maison parmi d’autres personnes, ainsi qu’une fourniture de 50 masques chirurgicaux et des instructions pour une utilisation correcte.

Mesures :
Le principal résultat est l’infection par le CoV-2 du SRAS chez le porteur du masque à 1 mois par un test d’anticorps, une réaction en chaîne de la polymérase (PCR) ou un diagnostic à l’hôpital. Le résultat secondaire était la positivité de la PCR pour d’autres virus respiratoires.

Résultats :
Au total, 3030 participants ont été assignés au hasard à la recommandation de porter un masque, et 2994 ont été assignés au contrôle ; 4862 ont terminé l’étude.
L’infection par le CoV-2 du SRAS s’est produite chez 42 participants à qui l’on avait recommandé de porter un masque (1,8 %) et chez 53 participants du groupe témoin (2,1 %). La différence entre les groupes était de -0,3 point de pourcentage (IC à 95%, -1,2 à 0,4 point de pourcentage ; P = 0,38) (rapport de cotes, 0,82 [IC, 0,54 à 1,23] ; P = 0,33). L’imputation multiple tenant compte de la perte au suivi a donné des résultats similaires. Bien que la différence observée ne soit pas statistiquement significative, les IC de 95% sont compatibles avec une réduction de 46% à une augmentation de 23% de l’infection.

Limitation :
Résultats non concluants, données manquantes, adhésion variable, résultats des tests à domicile rapportés par les patients, pas d’aveuglement et pas d’évaluation de la capacité des masques à réduire la transmission des maladies des porteurs de masque aux autres.

Conclusion :
La recommandation de porter des masques chirurgicaux en complément d’autres mesures de santé publique n’a pas réduit le taux d’infection par le SRAS-CoV-2 chez les porteurs de masque de plus de 50 % dans une communauté où les taux d’infection sont modestes, où il existe un certain degré de distanciation sociale et où l’utilisation générale des masques est peu courante. Les données étaient compatibles avec un degré moindre d’autoprotection.

Principale source de financement :
Les Fondations Salling.

Traduit avec http://www.DeepL.com/Translator (version gratuite)

Un autre article américain (en anglais) montrant que les masques n’ont pas d’incidence sur les statistiques du covid.

Et encore un autre article en anglais …

Un montage vidéo de Eric Remacle sur les avis de professionnels de santé à propos du port du masque

Un autre médicament efficace pour le Covid revendiqué par un médecin belge

Une lettre ouverte de Marc Wathelet, docteur en Sciences, virologue, spécialiste des coronavirus.

Monsieur le ministre de la Santé publique,

Dans ces temps difficiles, je voudrais attirer votre attention sur un traitement qui pourrait faire une différence énorme pour la santé des personnes qui se retrouvent infectées par le nouveau coronavirus en Belgique.

Il s’agit de l’ivermectine, un médicament bien connu et bien compris, découvert en 1975 et qui est repris sur la liste des médicaments essentiels de l’OMS. Il est utilisé chez l’homme pour traiter des infections par de nombreux types de parasites et présente également une action antivirale. C’est un médicament qui aurait justifié de bénéficier d’essais cliniques pour tester son efficacité contre le Covid-19, comme je l’avais suggéré en avril dernier. Pourtant, il a été écarté chez nous comme il a été ignoré dans le reste de l’Europe !

Mais, plus loin, ce médicament a été pris en considération : voici qu’une étude qui nous vient d’Égypte, pas encore publiée dans sa forme consolidée (preprint), s’est attachée à comparer les effets de l’ivermectine à ceux de l’hydroxychloroquine. Et les résultats sont spectaculaires!

Le traitement standard du Covid-19 dans plusieurs pays d’Afrique, dont l’Égypte, est la combinaison « hydroxychloroquine, azithromycine et Zinc ». L’étude en question compare ce traitement avec la combinaison « ivermectine, azithromycine et Zinc ». Elle comporte quatre bras de 100 individus chacun, où les formes modérées et les formes sévères de la maladie sont traitées avec l’une ou l’autre de ces deux combinaisons de médicaments.

Dans cette étude les chercheurs mesurent le pourcentage d’amélioration des symptômes couplée à une diminution de la charge virale, d’une part, et le nombre de décès (qui revient à un pourcentage puisqu’il y a 100 patients par bras), d’autre part.


Voici le résumé des résultats obtenus :

Hydroxychloroquine, formes modérées: 74% amélioration, 4 décès
Ivermectine, formes modérées: 99% amélioration, 0 décès
Hydroxychloroquine, formes sévères: 50% amélioration, 20 décès
Ivermectine, formes sévères: 94% amélioration, 2 décès

Avec des résultats aussi clairs, c’est le moment de faire preuve de vision !

Je compte sur les experts qui vous conseillent pour vous confirmer que le rapport bénéfices/risques de cette approche thérapeutique est largement en faveur de son utilisation pour les formes sévères de la maladie. Il est indispensable que ce traitement devienne disponible immédiatement dans les hôpitaux belges pour traiter les formes sévères du Covid-19.

Il ne s’agit pas de vérifier cette étude avec de nouvelles études avant de prendre cette décision, alors que nous avons une moyenne de quelque 200 décès quotidiens dus au Covid-19 en Belgique sur la dernière semaine, et donc une surmortalité d’environ 65% en ce moment. Nous n’en avons pas le temps !

Un « game-changer »

S’agissant des formes modérées de la maladie, l’ivermectine, bien que nécessitant à leur sujet une étude de confirmation, devrait également être disponible pour sa prescription par le personnel de première ligne quand le suivi médical peut être assuré de manière à en surveiller les effets secondaires potentiels.

Malheureusement, pour l’heure, ce médicament n’est disponible dans notre pays que dans sa formulation pour application topique, sous forme d’une crème (Soolantra®). Il est toutefois possible d’obtenir la formulation nécessaire, des comprimés de 3 ou 6 mg pour administration par voie orale, en utilisant la dénomination commune internationale, mais nos pharmacies n’en sont pas approvisionnées.

Je vous recommande dès lors 1) d’autoriser la forme orale de l’ivermectine dans notre pays ; 2) d’assurer l’approvisionnement de nos pharmacies avec ce médicament essentiel ; 3) d’assurer la transmission de cette information aux hôpitaux ; et 4) de faire organiser les essais nécessaires pour confirmer ou infirmer son utilité en première ligne pour les formes modérées.

Il faut avoir la lucidité de reconnaître qu’il s’agit d’un « game-changer » et qu’une réponse très rapide du gouvernement à cet égard permettrait de limiter les conséquences néfastes de la gestion par ailleurs mauvaise de la crise sanitaire dont souffre notre pays.

Je vous rappelle qu’aucun des vaccins en cours de développement n’est conçu pour induire une immunité mucosale, la seule qui soit potentiellement stérilisante et, donc, susceptible d’avoir un effet sur la transmission du virus.

De plus, les critères d’évaluation de ces candidats vaccins sont limités à la question de la réduction des symptômes, sans vérifier leur impact en termes de réduction des décès et de transmission du virus : ainsi la barre est-elle placée très bas pour assurer leur approbation. La réduction des symptômes, si elle peut être obtenue sans effets secondaires sérieux, est certes désirable, mais elle risque fort, dans le même temps, de promouvoir la transmission du virus car c’est bien l’apparition de symptômes qui incite le changement de comportement individuel susceptible de limiter la transmission.

L’importance de la vitamine D

Par ailleurs, les études s’accumulent qui indiquent qu’une carence en vitamine D favorise le développement de la forme sévère de la maladie : il s’agit, dès lors, de mettre en place, sans plus tarder, une large campagne d’information recommandant à chacun de supplémenter son alimentation avec de la vitamine D.

C’est là une mesure très simple et bon marché, qui peut avoir un effet très substantiel sur la morbidité et la mortalité associées au Covid-19. Rappelons que les séquelles inhérentes au Covid-19 sont conséquentes non seulement pour les individus concernés et leurs familles, mais aussi pour le budget public des soins de santé. Qu’attendons-nous alors pour prendre cette mesure simple ? Avons-nous oublié qu’il est plus facile de prévenir que de guérir ?

Agissez, Monsieur le ministre, agissez dès aujourd’hui, ne nourrissez pas la complainte narrative suivant laquelle le gouvernement n’aurait pas à cœur l’intérêt de sa population, mais seulement les desiderata des lobbies !

Je reste à votre disposition.

Marc Wathelet, docteur en Sciences

Voir l’article reprenant la lettre ouverte sur le site web du journal La Libre

Mise-à-jour du 23/12/2020: voir aussi l’article de France Soir consacré à la polémique sur ce médicament

Alexandra Henrion-Caude: origine du Sars-cov-2, brevet/scoop, actu 2e vague covid-19 & traitements.

Une analyse pour Nexus, d’Alexandra Henrion-Caude, en termes de mise-au-point d’une série de sujets occultés à propos de cette « épidémie ». Notamment des éléments d’analyse du virus en relation avec des brevets déposés, qui tendent à privilégier l’hypothèse d’une origine artificielle de celui-ci.

Sources :

Lien vers le brevet : https://patentimages.storage.googleap…

« La question de l’origine du SARS-CoV-2 se pose sérieusement », article CNRS : https://lejournal.cnrs.fr/articles/la…

Une épidémie de faux tests ?

Extraits d’un long article de France Soir intitulé « Et si la deuxième vague n’était que la houle des viroses respiratoires saisonnières ?« , très documenté sur l’état de fiabilité de l’interprétation des tests RT-PCR. Si on ne fait pas l’effort d’entrer un peu dans cette technicité, on se laisse manipuler par des charlatans qui en font leur veau d’or.

EXTRAITS:

. . . Cela est d’autant plus évident que l’utilité des tests RT-PCR, du moins comme arme principale pour prendre des décisions, interroge de plus en plus le monde médical. En effet, ces tests diagnostic posent plusieurs problèmes et notamment des problèmes de fiabilité. 

C’est ainsi que le Center for Disease Control and Prevention, l’équivalent de notre autorité sanitaire en France, a publié de nouvelles recommandations pour la durée de l’isolement et précautions pour les adultes atteints de COVID-19 ce 19 octobre 2020. On y apprend qu’il ne faut plus baser ses décisions dans la gestion de l’épidémie sur les tests PCR et donc sur les taux de contamination, car la précision de ces derniers ne permet pas d’être sûr que la positivité au test corresponde effectivement à une contamination récente car l’ARN viral peut demeurer 3 mois au moins dans l’organisme. Pis, une grande partie des positifs ne seraient plus du tout contaminants puisque pour les asymptomatiques et les formes modérées, la capacité de réplication du virus et donc sa contagiosité ne dure que 10 jours, et n’est que de 20 jours pour les formes graves et les immunodéficients (2). 

. . .  

Hormis le nombre de tests et donc de détection des cas positifs bien plus importants qui ne peut expliquer à lui seul cet écart considérable même quand on considère les estimations du nombre réels de contaminations en avril, il y a le rôle joué par les tests PCR. Ces derniers ont été conçus pour obtenir une très forte sensibilité, ce qui permet de détecter le moindre fragment de virus surtout au regard du degré d’amplification qui a été décidé. C’est l’inconvénient d’avoir des tests trop sensibles, il repère tout, même des fragments d’ARN viral inerte, sans aucun potentiel infectieux. C’est bien de cela dont il s’agit dans les recommandations du CDC : les tests diagnostic donnent et donneront lieu à une très grande majorité de faux positifsde porteurs du virus qui ne sont ni malades, ni contaminants, pour la simple raison que les personnes testées positives seront pour une grande majorité d’entre elle asymptomatiques et qu’il y a de grandes chances qu’une part de ces asymptomatiques aient même contracté le virus il y a plusieurs semaines. Car, comme le mentionne très bien le CDC, des fragments d’ARN viral subsistent jusqu’à trois mois au moins dans l’organisme. Vous pouvez par exemple avoir contracté le virus au moins de juillet ou au mois d’août, lorsque celui-ci ne causait alors plus trop de dégâts, et être aujourd’hui testé positif. 

Cela suffit à comprendre pourquoi le CDC recommande de ne plus baser sa prise de décision sur les tests RT-PCR. C’est l’inverse de ce qui est proposé par le ministre Véran et ceux qui nous gouvernent, qui bille en tête, ont eu la fulgurante idée de noyer les laboratoires sous les tests PCR pour le Covid-19. Lumineuse idée qui, outre le fait d’empêcher à l’instar des réanimations, de prendre en charge de nombreuses maladies pourtant plus létales, rallonge les délais pour obtenir les résultats des tests, qui en deviennent pour le coup encore plus inutiles. A tel point que le coût de ces tests qui s’élèvent déjà à plusieurs centaines de millions d’euros et dépassera à n’en pas douter plusieurs milliards, pourrait mettre en péril la santé financière de la sécurité sociale. Il est alors intéressant de consulter la notice des différents tests : pour tous, il a toujours été mentionné que le résultat du test devait toujours être interprété à l’orée de l’analyse clinique. Il était donc inutile dès le départ, et bien avant que la CDC en vienne à ces conclusions, de démultiplier les tests notamment pour les asymptomatiques. Pis, cette frénésie de tests voulue par notre ministre chamboule tout, aura annihilé le peu d’utilité que l’on aurait pu avoir de ces tests.

A la pêche aux houles, houles, houles 

Il faut alors bien comprendre comment fonctionnent ces tests RT-PCR.
Il s’agit de fabriquer des amorces que nous pouvons considérer comme des hameçons. Nous en utilisions un seul au printemps, mais depuis les tests PCR multiplex se sont démocratisés et nous utilisons maintenant deux à trois amorces, c’est ce que l’on appelle le multiplex. Cela revient donc à avoir trois hameçons sur sa canne à pêche. Ce qu’il faut savoir, c’est que ces hameçons sont particuliers : ils sont censés être spécifiques à des régions du poisson, le Covid-19 et ne sont censés reconnaître que ces régions présentes sur le Covid-19. En terme plus classique, ces amorces sont spécifiques de séquences de nucléotides exclusives du Covid-19. 

Le problème avec ces hameçons, c’est que même s’ils étaient ultra spécifiques au Covid-19, ils ne peuvent distinguer les poissons vivants des poissons morts. Or dans la mare très riche que forment nos muqueuses nasales et pulmonaires, il y a énormément de poissons morts pour une personne qui a contracté le virus même trois mois avant. Il y a donc de fortes chances d’attraper un poisson mort chez de nombreuses personnes comme le CDC le signale. 

Vous pouvez observer ci-dessus l’ARN du virus où sont localisées les gènes dont on se sert pour fabriquer les amorces qui permettent de déceler sa présence. On se sert de logiciels puissants pour trouver des séquences spécifiques à ce virus et à aucun autre. Comme pour la prise de décision qui repose sur de gros ordinateurs qui projettent l’hécatombe qui vient en reposant leurs calculs sur l’accélération du taux de contaminations, là encore, on s’en remet à des processeurs, à de l’intelligence artificielle qui est au cerveau humain ce que la neige artificielle est au flocon. Car bien évidemment, ce modèle est un modèle théorique, qui même s’il a été testé en laboratoire, in vitro, n’en demeure pas moins théorique. C’est un peu comme pour les tests PCR ou la conception du Remdesivir, ce médicament miracle qui ne soigne rien : on a fait passer l’outil avant l’idée, on a confié nos responsabilités à des jouets technologiques plutôt que de mettre ces jouets au service de nos responsabilités. Cette recherche d’amorce permet le séquençage des génomes viraux et le croisement de milliers de souches de virus différents est indéniablement un bel outil, un outil révolutionnaire. Mais à la manière des tests, il ne remplacera jamais une analyse humaine, une analyse clinique, inférentielle qu’aucune de vos consoles de jeux ne parviendra à effectuer. Jamais, je l’espère, au regard du pouvoir déjà bien trop important que vous offrez à ces innovations technologiques.  

L’ARN d’un virus est une molécule fragile. C’est d’ailleurs cela qui explique le nombre de mutations très important malgré la petitesse des fragments en question. Sans rentrer dans le détail, il suffit de comprendre que les modèles informatiques qui projettent un « lien » entre les amorces des tests PCR et l’ARN viral est purement hypothétique et que les conditions in vivo induisent que la variété des fragments ARN présents dans les muqueuses respiratoires qui pourraient effectivement correspondre aux amorces des tests est considérable : fragments d’ARN humain, fragments d’ARN de tous types de virus ou de bactéries mortes, fragments d’ARN de SARS-Cov-2 morts. Une récente publication explique même que « de façon inattendue, les données obtenues montrent qu’en plus des espèces d’ARN « matures », le plasma humain contient une proportion importante de fragments d’ARN « dégradés » et que « une proportion substantielle d’exARN d’origine non humaine, proviennent de la peau humaine et du microbiote intestinal, y compris le microbiote viral. Ces exARN exogènes représentent jusqu’à 75-80% de l’ARN total contenu dans les vésicules extracellulaires hautement purifiées » (3). Or comme nous l’avons déjà expliqué, l’ARN est une molécule fragile et encore plus lorsqu’elle est sous forme dégradée dans le milieu extracellulaire. La probabilité d’avoir un nombre incalculable d’ARN dégradé et recombiné est très forte. D’ailleurs ce nouvel univers des ARN extracellulaires et notamment ceux contenus dans les vésicules majoritairement d’origine microbienne font de l’objet de recherches très intense depuis quelques années pour leur potentiel rôle de biomarqueurs de maladie chronique comme le cancer. Mais les scientifiques se heurtent au même obstacles que nos élites sanitaires qui font reposer leurs décisions sur des tests RT-PCR, à la différence qu’eux en ont conscience : il est très compliqué de purifier l’ARN extracellulaire vésiculaire et il y a un consensus à adopter d’après la Société internationale des vésicules extracellulaires, « nos connaissances incomplètes de la nature des ARN extracellulaires vésiculaires et de la façon de les étudier efficacement et de manière fiable, interdit actuellement la mise en œuvre de normes d’or dans la recherche de cet ARN » (4). En somme, nous ne savons rien de la diversité des ARN contenus dans les fluides humains et donc dans les muqueuses des voies respiratoires.  

Or cet aveu d’ignorance est tout aussi vrai pour l’ARN du SARS-Cov-2 : celui-ci n’a jamais été purifié à partir des fluides extracorporels humains. Comme le spécialiste australien des maladies infectieuses Sanjaya Senanayake, l’a déclaré dans une interview à la télévision « ABC TV » en réponse à la question : Quelle est la précision du test COVID-19 ? »  

« Si nous avions un nouveau test pour détecter le staphylocoque doré dans le sang, nous avons déjà des hémocultures, c’est notre étalon-or que nous utilisons depuis des décennies, et nous pourrions comparer ce nouveau test à cela. Mais pour COVID-19, nous n’avons pas de test de référence. »

Cela signifie que les tests PCR même multiplex qui nous servent de diagnostic actuellement et sur lesquels se fondent les arguments et les prises de décisions de nos autorités sanitaires ne se basent que sur le séquençage du génome du virus et sur les essais in vitro donc sur un modèle purement spéculatif qui ne tient pas compte des multitudes interactions que subit l’ARN viral dans notre organisme et surtout, de la variété incommensurable des fragments d’ARN présents dans nos muqueuses respiratoires. Le Dr Charles Calisher, virologue chevronné, a reconnu lors d’une interview « qu’aucune publication à ce jour ne travaillait sur un virus SARS-Cov-2 isolé et purifié. » Cela reviendrait à dire qu’en fait qu’on ne peut pas conclure que les séquences génétiques d’ARN, que les scientifiques ont prélevées dans les échantillons de tissus préparés dans les essais in vitro mentionnés et pour lesquelles les tests PCR sont finalement « calibrés », appartiennent à un virus spécifique – dans ce cas SRAS-CoV-2

Même le professeur Chen Wang, vice-président de l’Académie chinoise d’ingénierie et président de l’Académie chinoise des sciences médicales et président du Peking Union Medical College, a admis en février 2020 que les tests PCR n’étaient « précis qu’à 30 à 50% ». Le Dr Sin Hang Lee du Milford Molecular Diagnostics Laboratory a envoyé une lettre à l’équipe de lutte contre les coronavirus de l’Organisation Mondiale de la Santé et à Anthony S. Fauci, conseiller auprès du président des Etats-Unis quant à la Santé Publique, le 22 mars 2020, disant que : « Il a été largement rapporté dans de sérieux médias sociaux que les kits de test RT-qPCR [Reverse Transcriptase quantitative PCR] utilisés pour détecter l’ARN du SARSCoV-2 dans les échantillons humains génèrent de nombreux faux positifs et ne sont pas assez sensibles pour détecter certains cas réels positifs. »

Et cela est d’autant plus évident quand on sait que des fragments d’ARN viral du SARS-Cov-2 mais aussi de tous les virus respiratoires pouvant provoquer des infections respiratoires aiguë et qui sont très variés (adénovirus, rhinovirus, entérovirus, influenza…) peuvent rester 3 mois dans les muqueuses des voies respiratoires. Alors que dire des multiples recombinaisons possibles de ces fragments d’ARN soumis à l’environnement très réactif de nos muqueuses. En considérant toujours ces tests RT-PCR comme des cannes à pêche munies de plusieurs hameçons, c’est comme si des hameçons spécialisés pour la pêche à la carpe capturaient de la perche, du brochet, du goujon, de la truite, du silure et même des algues. 

De faux tests peuvent donner lieu à de fausses épidémies 

Il y a une jurisprudence, qui démontre mieux qu’on ne pourrait le faire qu’il y a de fortes chances que cette nouvelle vague tant annoncée par nos autorités sanitaires et de nombreux médecins trop désireux d’avoir eu raison d’être alarmistes ; cela permet aussi de dénoncer les « rassuristes ».  

En effet, une fausse épidémie a déjà été montée de toutes pièces en se basant sur ces fameux tests RT-PCR. Il s’agit d’une épidémie de coqueluche survenue dans le New Hampshire aux Etats-Unis en 200,6 (5). Des milliers de personnes travaillant dans le centre hospitalier de Dartmouth ont été testées par test PCR et ont été vaccinés puis traités aux antibiotiques pour que l’on finisse par découvrir huit mois plus tard qu’aucune de ces personnes n’avait contracté la coqueluche. Un cas similaire est intervenu à l’hôpital pour enfants de Boston avec toujours une épidémie de coqueluche révélée par des PCR. Les cultures en laboratoire, là encore, ne révèleront plus tard qu’aucun des enfants n’avait contracté la coqueluche. On parle pourtant ici de bactéries et de la molécule d’ADN bien plus robuste que l’ARN…Ces deux cas d’écoles interrogent sur l’opportunité d’utiliser à nouveau la culture des pathogènes suspectés pour s’assurer du diagnostic précoce. 

Dans notre cas, la supposée deuxième vague de l’épidémie de Covid-19, plusieurs publications interrogent justement la spécificité des tests RT-PCR utilisés pour diagnostiquer la maladie. En effet, une publication récente, qui n’a pas vocation à dénoncer ces tests, ni même à remettre en cause la reprise de l’épidémie, propose innocemment d’inclure une nouvelle amorce dans les tests PCR car d’après les auteurs :  

« L’OMS recommande des gènes RdRP, E et N pour la détection du coronavirus (Corman et al., 2020a) : dépistage par gène E pour la première ligne, gène RdRp pour l’essai de confirmation et gène N pour un test confirmatoire supplémentaire. Bien que ces gènes aient été signalés comme cibles potentielles pour la détection du coronavirus, nous avons découvert qu’un seul d’entre eux (RdRP_SARSr-P2) était presque spécifique pour le nouveau coronavirus et que les autres sondes introduites détecteraient les autres types de coronavirus. À cet égard, les résultats des tests faussement positifs peuvent s’étendre pour la Covid-19, et de nombreux patients présentant peuvent être infectés par les autres types de coronavirus » (6). D’après cette équipe de chercheurs et leur publication validée et soumise à un comité de lecture, le test RT-PCR le plus élaboré, le multiplex, qui s’appuie sur 3 amorces, pourrait générer des tests positifs Covid-19 alors qu’il s’agirait d’autres coronavirus, dont les souches sont très nombreuses.Mais il y a plus encore, les auteurs expliquent que deux des trois amorces ne sont que très peu spécifiques et que la troisième peut aussi induire des réactions croisées avec d’autre coronavirus. Or les laboratoires biologiques valident la positivité des tests Covid-19 même lorsqu’une seule des trois amorces est positive. Il est donc indéniable que les personnes testées positives sont probablement porteuses de nombreux coronavirus que le SARS-Cov-2, ainsi que comme on peut le penser de d’autres virus saisonniers. Ci-dessous, vous pouvez apprécier le protocole de test d’un des plus grands laboratoires d’analyse biologique français : 

Donc, outre toutes les remarques faites précédemment sur la diversité des fragments d’ARN présents dans nos muqueuses respiratoires et le fait que même les fragments réels d’ARN du SARS-Cov-2 ne nous renseignait en rien sur la capacité de réplication de ces ARN viraux donc sur la contagiosité des porteurs, on apprend que les tests diagnostiques ne sont pas spécifiques du SARS-cov-2 et peuvent détecter d’autre coronavirus, ainsi que, d’après nous, des adénovirus, des entérovirus et des rhinovirus. 

En d’autres temps, nous serions en pleine épidémie de rhinovirus et les urgences devraient être saturées comme chaque année par l’arrivée massive de malades souffrant de viroses respiratoires aiguës : bronchiolites, rhinites, pneumopathies virales, virus syncitial. Car toutes les années, à la même époque, c’est-à-dire quelques semaines après la rentrée des classes, les services hospitaliers sont plus que saturés.

Or, depuis l’arrivée du Covid-19, c’est comme si toutes les autres pathologies virales respiratoires avaient disparu. La grippe et ses différentes souches avec à peine une centaine de cas pour 2020 comparativement aux milliers de cas annuels habituellement observés, semble être partie en vacances, les rhinovirus, adénovirus, entérovirus semblent s’être confinés en présence de la Covid-19. On estime que les viroses respiratoires, toutes confondues, sont responsables de 8 % des décès chaque année. Cela signifie qu’en prenant la fourchette la plus basse de mortalité, on estime à quelque 44 000 décès pour viroses respiratoires aiguës mais les chiffres bruts démontrent que l’on est bien en-deçà du chiffre réel. 

Afin de ne pas induire des discussions interminables sur les chiffres, nous prendrons la fourchette basse, à savoir 44 000 décès pour infections virales aiguës des voies respiratoires. Actuellement sur les décès dus à la Covid-19, nous nous approchons des 35 000 décès alors que nous sommes bientôt au mois de novembre et donc à la fin de l’année. Or si l’on considère que la grippe, principale cause de mortalité dans cette catégorie de décès, les viroses respiratoires, ne provoquera cette année tout au plus quelques centaines de décès, on peut penser que le nombre de décès suite à une infection virale aiguë des voies respiratoires n’excédera pas le chiffre moyen des décès annuels pour cette même cause, à savoir 44 000, en incluant les décès dus au Covid-19. C’est d’ailleurs pour cela que malgré la pandémie de Covid-19 et le nombre important de décès au printemps, nous n’observons qu’une surmortalité très faible (6 à 9%) due à la Covid-19, par rapport aux années 2018 et 2019. 

Alors, bien sûr nos « élites alarmistes », expliqueront que ce qu’elles observent dans les hôpitaux ne prête pas à discussion. Sauf que là encore, cela n’est que de la communication. Aucun de ces médecins, chercheurs ou carriériste politique ne peut affirmer que la situation actuelle est due au Covid-19 et encore moins que la saturation des hôpitaux actuelle est plus importante cette année que les autres, à moins d’admettre que l’épidémie de Covid-19 a fait partir en vacances tous les autres virus responsables d’infections virales respiratoires aiguës. Sur quoi se baseraient-ils d’ailleurs pour démontrer que c’est bien la Covid-19 qui génère cet afflux de patients à l’hôpital ? Sur les tests PCR ? Nous avons établi qu’ils ne permettaient pas de distinguer sérieusement l’étiologie de l’infection respiratoire responsable des hospitalisations, des admissions en réanimation et mêmes des décès. Sur l’analyse clinique ? Là encore, nous sommes au regret de leur apprendre, et même la HCSP s’en émeut, que la distinction clinique entre les infections causées par les virus de la grippe ou d’autres virus respiratoires n’était pas aisée pour ne pas dire quasi impossible tant la symptomatologie est semblable entre ces différentes atteintes (7). En effet, dans son avis relatif à la préparation des épidémies de virus hivernaux en période de circulation du SARS-CoV-2 du 17 septembre 2020, la HCSP affirme clairement que « les éléments strictement cliniques ne permettent pas d’éliminer formellement un diagnostic de Covid-19, particulièrement chez les personnes âgées. » 

Pis, la haute autorité sanitaire reconnaît que « chez l’adulte comme chez l’enfant, toutes les pathologies virales saisonnières respiratoires ou digestives peuvent donner des signes compatibles avec un Covid-19 ». 

Mieux, la HCSP écrit : « S’il existe des signes cliniques hautement évocateurs du Covid-19 (anosmie ou agueusie, cf.infra), aucun n’est toutefois pathognomonique de cette infection. En outre, de nombreux signes cliniques sont communs aux infections par les virus respiratoires, en particulier à la grippe et au Covid-19 ».

A moins de traiter de complotiste, le CDC autorité sanitaire américaine qui remet en cause la précision des tests PCR, ainsi que la HCSP, autorité sanitaire française qui dit clairement que les signes cliniques ne sont pas pathognomoniques de la Covid-19, nos alarmistes n’ont plus guère d’arguments pour affirmer de manière péremptoire comme ils le font que nous sommes devant une nouvelle vague de Covid-19. 

Quoi qu’il en soit, en science, lorsque l’on est confronté à plusieurs hypothèses, on choisit la plus simple. Ici, deux hypothèses sont plausibles au regard des éléments que nous venons de présenter et des chiffres de la mortalité : soit il y a un amalgame de toutes les viroses respiratoires aigües qui chaque année font imploser nos hôpitaux, soit les autres pathologies virales ont disparu, sont parties en vacances ou se sont confinées en présence du SARS-Cov-2. A vous de choisir, quelle hypothèse est la plus simple et la plus plausible. Pour le docteur Bensadoun, médecin consultant pour Cnews, qui n’a rien d’un complotiste, ni d’un « rassuriste », dit clairement cela : Dans mon cabinet, toutes les rhino-pharyngites que j’aurais étiquetées « rhino-pharyngites » les années précédentes je les étiquette « Covid ». A bon entendeur. 

En conclusion, le collectif citoyen et l’association « Bon sens » avec laquelle nous travaillons, demandent au Président de la république d’exiger une analyse plus sérieuse et plus précise de la situation épidémiologique en France avant de s’engager dans un contresens et de prendre des décisions dont les conséquences seront assurément bien plus funestes que la Covid-19. A cet effet, il semble indispensable de mettre en place d’autres éléments diagnostics permettant de minimiser les risques de confusion entre la Covid-19 et les autres infections virales respiratoires saisonnières. Aussi, dans un souci de transparence et d’apaisement du sentiment anxiogène délétère qui s’empare de nombre de nos concitoyens, nous demandons aux autorités sanitaires de fournir des données plus précises, incluant entre autres la place des autres pathologies, notamment respiratoires, dans la saturation habituelle des services hospitaliers. 

Ceci sont des extraits de l’article plus complet et plus long de France Soir.

Merci à France Soir pour ses articles et analyses indépendantes et très fouillées.

N’hésitez pas à soutenir France Soir (dès 1€/mois).