Un VAKX1 pour 8 milliards d’humains !

Oui ! un défi immense pour v.a.k- xiner 8 milliards d’être humains. En gros on ne vous demande pas votre avis vous êtes IN THE BOX. Mais on est bien d’accord que nous ne sommes pas in The box. La question, c’est pourquoi, ça va fonctionner cette fois-ci ? Pourquoi la campagne de v.a.k- xina-tion mondiale va voir le jour ? Dans cette étude que Mika Denissot vous présente, vous verrez les différentes propositions, les sanctions, les actions autour du plus grand business rentable pour 2021. Attention ca va piquer !

Confirmation de la présence de nanoparticules d’aluminium dans les vakx1.

Déclaration d’un médecin pédiatre américain devant une commission parlementaire de la santé.
Les vaccins contiennent des nanoparticules d’aluminium et les effets de ceux-ci sur le cerveau ne sont pas du tout étudiés mais pourraient expliquer les maladies type alzheimer, maladies chroniques inflammatoires, …
Par ailleurs, les fragments de virus introduits via les vaccins peuvent être semblables à des ceux de cellules humaines ce qui pourrait expliquer les déclenchement de maladies auto-immunes.
Attention aux apprentis-sorciers !

Louis Fouché: covid, vakx1 et conséquences

A ne pas manquer !
Comme toujours interventions très brillantes et très nourrissantes (séparée en 6 vidéos) du Dr Louis Fouché sur les libertés, l’information et les communications sur la pandémie, le virus, les vaccins, … Toujours très documenté et pertinent.
Je conseille particulièrement le n° 4.

Le Dr Pascal Sacré livre son analyse en toute liberté.

Le Dr Pascal Sacré, licencié pour s’être exprimé sur la non fiabilité des tests PCR notamment, livre toutes ses opinions lors d’une interview pour Kairos Presse. Il s’y exprime sur la gestion générale de la médecine, les tests, la fausse épidémie du Covid, les vaks1, la corruption de la médecine et des gouvernants, ….

Suite à cet interview, le Docteur Sacré a lancé un appel à la désobéissance civile dans la vidéo Facebook suivante:

https://fb.watch/23Qab48cZL/

Un décryptage des techniques de communication qui nous manipulent

Dans une communication, l’émotionnel est touché avant le rationnel. Il est facile alors de faire peur, de faire culpabiliser, de valoriser ou de dévaloriser quelqu’un pour le relier à sa cause. 
Mais quelles sont ses stratégies ? 
Comment les repérer, comment conserver notre discernement, notre libre arbitre ?
Comment écouter notre cœur, notre bon sens, pour agir non pas à partir de notre peur, mais à partir de ce qui réellement nous semble cohérent? 
Car le cœur est une véritable intelligence. Le cœur sait. C’est un véritable cerveau. C’est un centre de compréhension dont le rayonnement électromagnétique est plus large que celui du cerveau. 
Cela nous demande d’être calme, de ne pas excessivement réagir, de faire preuve de discernement.  D’écouter la situation dans son ensemble, surtout d’écouter notre intuition et de faire confiance. Car je crois que profondément, comme un animal dans la nature sait repérer les herbes et les plantes qui sont bonnes pour lui, qu’il sait reconnaître les prédateurs, les pièges et les partenaires avec lesquels il peut cheminer, une partie de nous sait. 
Elle s’appelle l’intuition. Encore faut-il l’écouter. Cette situation m’a donné envie de vous offrir cette vidéo. Puisse t’elle vous éclairer dans cette période ou plus que jamais. Nous avons besoin de développer notre discernement.
Arnaud Riou

Les différentes techniques évoquées par Arnaud Riou:
diviser, valoriser vs dévaloriser, culpabiliser, fustiger, infantiliser, simplifier de façon excessive, ironiser, liens subjectifs de causalité, stratégie de la grenouille, rumeurs, …

Merci à Francis de m’avoir transmis cette vidéo.

Quand de grands médecins dénoncent les politiciens jouant au docteur

Le Dr Roger Hodkinson, professeur de médecine et actif dans un laboratoire vendant des tests intervient dans une assemblée publique au Canada pour dénoncer l’absurdité des mesures politiques de port du masque, de distanciation physique, de confinement et de destruction de l’économie etc … totalement disproportionnées par rapport à l’aspect peu dangereux de ce virus.

Un autre grand médecin s’exprime sur le même sujet.

Le grand Reset, le Forum Economique Mondial, l’ONU

La crise du Covid est un accélerateur,
4ème Révolution Industrielle,
BBB, Build Back Better,
The future we want,
Fusion entre nos identités physiques, digitales et biologique,
Vous ne serez plus propriétaires de rien et vous serez heureux, …

Tels sont les slogans coordonnés entre les chefs de gouvernement, le World Economic Forum et même l’ONU colonisé par les multinationales du World Economic Forum. Ce n’est plus un complot, tout est écrit et dit dans tous les discours.
Un documentaire très instructif.

Voir aussi le Global Alliance For Responsible Media (GARM): The Global Alliance for Responsible Media (GARM) a créé un partenariat avec le World Economic Forum. Cette page vous permettra de voir les principales multinationales actives dans le GARM et le World Economic Forum.

Selon une étude scientifique, le confinement et les mesures sanitaires strictes n’auraient aucun impact sur la mortalité du virus.

L’étude publiée le 19 novembre, sur Frontier in Public Health sur la mortalité du Covid19 dans 188 pays, confirme peut-être ce que beaucoup pensent tout bas : il n’existerait aucun lien entre le confinement, des mesures sanitaires strictes et la mortalité du virus.

Pour arriver à cette conclusion, les chercheurs ont notamment étudié, pour chaque pays :
– l’espérance de vie ;
– le nombre de décès liés au cancer, aux maladies cardiovasculaires, chroniques et infectieuses ;
– les taux d’obésité, d’inactivité et de sédentarité ;
– la richesse économique ;
la sévérité des mesures anti-covid des gouvernements ; 

 Deux types de pays ont alors émergé  :
Les pays dits « riches », avec des taux élevés de maladies chroniques et cardiovasculaires et une population vieillissante et sédentaire : ils se situent en Amérique du Nord, en Europe et dans une partie de l’Asie ;
Les pays moins riches, avec des populations plus jeunes et des taux élevés de maladies infectieuses (dengue, malaria, etc.), plutôt localisés en Afrique, en Amérique du Sud et en Asie du Sud-Est. 

Et voici ce que conclut l’étude : les pays les plus riches ont payé le plus lourd tribut face au virus, sans lien avec la sévérité des mesures imposées.

Dans les pays riches, nous avons tendance à vivre plus longtemps mais aussi à être moins actifs que dans les pays moins développés.
Or, la sédentarité est une cause majeure de comorbidités : hypertension, diabète et troubles cardiovasculaires pour les principales. 

La mortalité élevée du virus dans nos sociétés est donc surtout liée à la vieillesse de la population, et à notre mode de vie.

Et les chiffres donnent raison aux chercheurs :

En France, depuis le 1er mars 2020,
– 91,7 % des décès du Covid avaient plus de 65 ans, avec un âge médian de 84 ans [i] ;
– 65 % des morts du virus souffraient d’une co-morbidité (une hypertension artérielle dans 24 % des cas, une pathologie cardiaque pour 35%) ;
– 44 % de ces décès ont eu lieu en maison de retraite, une proportion atteignant 59 % en Norvège et 72 % en Espagne[iii].

Au 5 novembre 2020, le taux de mortalité était de 0,05 %. Vous aviez donc 1 risque sur 2000 de mourir du virus… et 99,05 de chance d’y survivre!

À titre de comparaison, au cours de sa vie, une personne à 1 risque sur 6 de mourir d’un accident cardiovasculaire. Et cela ne nous empêche pas de vivre !

Le problème, c’est que l’incertitude dans laquelle nous plonge cette pandémie nous fait surestimer les risques.

Et les médias ou le gouvernement en profitent pour imposer des mesures de plus en plus décriées et pesantes pour beaucoup d’entre nous.

Abstract de l’étude:

Contexte

Les territoires de développement humain ont été sévèrement limités par la pandémie Covid-19. Une dynamique commune a été observée, mais sa propagation n’a pas été homogène sur chaque continent. Nous visions à caractériser les paramètres non viraux les plus associés au taux de mortalité.

Méthodes

Nous avons testé les principaux indices de cinq domaines (démographie, santé publique, économie, politique, environnement) et leurs associations potentielles avec la mortalité de Covid-19 au cours des 8 premiers mois de 2020, à travers une analyse en composantes principales et une matrice de corrélation avec un test Pearson de corrélation. Les données de tous les pays ou états des pays fédéraux, indiquant au moins 10 cas de décès, ont été extraites des sites publics officiels. Pour les pays qui n’ont pas encore terminé la première phase épidémique, un modèle prospectif a été calculé pour fournir des options d’évolution des taux de mortalité.

Résultats

Des taux de mortalité Covid plus élevés sont observés dans la latitude [25/65 °] et dans les plages de longitude [−35 / −125 °].
Les critères nationaux les plus associés au taux de mortalité sont l’espérance de vie et son ralentissement, le contexte de santé publique (charge des maladies métaboliques et non transmissibles (MNT) par rapport à la prévalence des maladies infectieuses), l’économie (croissance du produit national, soutien financier) et l’environnement (température , indice ultraviolet).
La rigueur des mesures prises pour lutter contre la pandémie, y compris le verrouillage, ne semble pas liée au taux de mortalité.

Conclusion

Les pays qui ont déjà connu une stagnation ou une régression de l’espérance de vie, avec des revenus élevés et des taux de MNT, avaient le prix le plus élevé à payer. Ce fardeau n’a pas été allégé par des décisions publiques plus strictes.
Des facteurs inhérents ont prédéterminé la mortalité Covid-19: leur compréhension peut améliorer les stratégies de prévention en augmentant la résilience de la population grâce à une meilleure forme physique et une meilleure immunité.

Philippe Guillemant: le but de la vaksination n’est pas d’ordre sanitaire.

Article de Philippe Guillemant sur le site http://tout1savoir.eklablog.com/

Le principal but de la vaccination est de parvenir à une normalisation du port d’identité numérique par chaque citoyen. Il sera en effet permis que le contrôle de ses droits d’accès à différents lieux (restaurants, boutiques, gares etc.) se fasse de manière automatique, ce qui ouvrira un immense marché, celui des objets connectés, tellement savoureux qu’il est capable de transformer des informaticiens en virologues. 🙂

Cela permettra également l’introduction d’une monnaie numérique déjà préparée par la suppression progressive de l’argent liquide.

Il y a deux cas à considérer :

– Port d’identité numérique non intimement liée au corps : mobile, bracelet, montre, sac à main…
– Port d’identité numérique intimement liée au corps : bague, puce sous la peau, identification génique…

Dans le second cas il sera impossible, sauf opération chirurgicale, de se débarrasser de son identité.

Dans un premier temps seul le premier cas est à considérer sérieusement. Ce n’est que lorsque l’usage d’une identité numérique sera normalisé par l’habitude (de vivre autrement) que le second cas s’imposera naturellement pour renforcer la sécurité de l’usage.

Aujourd’hui ce port d’identité numérique est déjà réalisé via nos mobiles, mais aucun usage n’en est fait, sauf marginal comme dans le cas de l’application StopCovid. Tout le monde a le droit d’entrer dans n’importe quelle boutique et de voyager sans être obligé d’avoir un portable. D’autre part le traçage des déplacements permis par un mobile est très grossier, sa précision étant comprise entre 1 et 10 mètres. On peut considérer que pour l’instant, avoir un portable est inoffensif.

Tout cela pourrait changer avec le contrôle vaccinal automatisé et la généralisation des objets connectés via la 5G et même dès la 4G. En particulier le traçage ne serait plus réalisé par GPS mais par analyse et triangulation de signaux via les objets alentours et sera à terme 100 à 1000 fois plus précis, à mesure que la technologie évoluera.

Le port non lié au corps d’identité numérique, dans un environnement peuplé d’objets connectés (maisons, voitures, routes, villes…) permettrait les recueils de données suivants par une I.A. :

– Vérification d’autorisation d’accès pour les vaccinés
– Contrôle de vitesse et stationnement (voiture connectée)
– Identification de toutes sortes d’infractions à la conduite
– Identification des personnes avec qui l’on déjeune
– Mémorisation de tous les déplacements
– Calcul de temps de travail ou temps de présence…
– Détection de déplacement inhabituel…
– Etc.

Il convient de préciser qu’aucune loi ne pourrait empêcher l’implémentation des algorithmes correspondants, mais seulement en interdire l’usage. Toutefois, il serait extrêmement difficile de détecter qu’un tel usage n’est pas effectué. Seule son exploitation pourrait être rendue visible, mais cela laisse une grande place à une exploitation inavouée, par exemple par une société d’assurance où le calcul des droits est déjà réalisé de façon informatique.

Considérons maintenant le deuxième cas, et allongeons la liste précédente :

– Maison intelligente (interactions, commandes, dialogues…)
– Analyse d’activités privées (dormir, lire, faire l’amour…)
– Surveillance de l’activité des enfants
– Analyse des interactions familiales
– Analyse de situation (repos, activité, chute…)
– Analyse de comportement (geste brusque, activité sportive…)
– Détection et mémorisation des habitudes.
– Etc.

J’en oublie certainement, sachant qu’il est difficile d’imaginer d’avance tout ce que la quatrième révolution industrielle pourrait nous inventer. Je ne parle ici que d’un transhumanisme très doux, presque acceptable, sans faire référence à quoi que ce soit d’intrusif comme une puce dans le cerveau, des nanorobots dans nos veines ou une vision artificielle et connectée. Mais il va de soi que l’acceptation de ces technologies intrusives est conditionnée à l’acceptation de l’usage d’identité numérique.

La question de savoir si nous allons effectivement rentrer dans ce nouveau monde, ou pas, va donc dépendre du niveau d’acceptation du vaccin. Il est en effet peu probable que l’on oblige chaque citoyen à porter une identité numérique lors de ses déplacements si 50% de la population n’est pas vaccinée, car on ne va pas limiter à ce point la liberté de circulation. Par contre, si seulement 5% de la population n’est pas vaccinée, il est fort probable qu’on entrera dans ce nouveau monde.

La réalité sera évidemment bien plus complexe que cette simplification binaire, qui n’a d’autre but que d’éveiller aux véritables enjeux.

Donc, je le répète, nous ne sommes pas confrontés à un problème sanitaire avec le virus. Ce problème-là est pinuts à coté du choix de société qui se trouve devant nous, qu’une politique de gouvernance mondiale semble avoir déjà fait à notre place.

C’est cela qui explique la dictature sanitaire qui de façon rationnelle n’a aucune autre raison d’être.

Charles Gave sur l’ineptocratie et le grand Reset

Le grand réaménagement (reset) ou le triomphe de l’ineptocratie

Lire l’article complet sur le site de l’Institut des Libertés de Charles Gave

En voici quelques extraits:

En 2011, un politicien travailliste anglais, Paul Flynn, eut une merveilleuse inspiration en inventant une nouvelle notion, l’ineptocratie. 

“L ‘ineptocratie est un système de gouvernement dans lequel les moins capables de diriger sont élus par les moins capables de produire quoique ce soit pour subvenir à leurs propres besoins, mais qui, néanmoins, sont récompensés en recevant biens et services produits par des gens à qui l’on vole le produit de leur travail et dont le nombre ne cesse de diminuer. »

….

Malgré toutes ces forfaitures, ils sont bel bien au bout du rouleau et du coup, comme tous les mauvais gérants, ils pensent à faire plus de ce qui a déjà échoué et donc à mettre le pied sur l’accélérateur et nous le savons par l’intermédiaire d’un Suisse, Monsieur Schwab, l’organisateur du forum de Davos.

Pour lui, le nouveau monde devrait s’organiser autour de trois principes qui seront bien sûr les fondations de ce grand réaménagement. Je donne en premier le principe, et en second la traduction pour que même le lecteur du Monde le plus obtus comprenne (Je doute d’en avoir beaucoup dans le lectorat de l’IDL).

  1. Il faut réorganiser nos sociétés pour qu’elles soient plus « justes ». Traduction, les impôts sur la classe moyenne et ses actifs vont exploser, les paresseux vont toucher plus.
  2. Les Etats doivent investir massivement dans l’économie « verte » et transformer de fond en comble les villes et les lieux de production. Traduction : Le capitalisme de connivence a de beaux jours devant lui et votre immobilier ne vous appartiendra plus. Votre niveau de vie va baisser profondément.
  3. Entre le Covid et le réchauffement atmosphérique, nous avons besoin absolument d’un gouvernement mondial tant les problèmes ne peuvent plus être gérés à l’échelle nationale. Traduction : Dites adieu à la démocratie, de puissants génies comme Jacques Attali vont se coopter et assureront notre bonheur. Mais ils seront malheureusement obligés d’ouvrir des camps de concentration pour y mettre l’auteur de ces lignes et nombre de ses lecteurs, mais on ne fait pas d’ omelettes sans casser des œufs.

Je n’ai jamais été un « conspirationniste », pensant de façon générale que la bêtise humaine suffisait à expliquer nombre de désastres, mais je dois dire que le Covid est arrivé vraiment à point nommé pour donner une apparence de légitimité aux trois propositions mentionnées ci-dessus.

….

Ils vont donc nous piquer nos actifs, et   cela   détruira nos démocraties.

Pour résoudre leurs problèmes, la solution la plus simple est en effet d’aller chercher l’argent là où il est, c’est-à-dire dans vos poches. Et donc, pour résoudre les problèmes fiscaux des états gérés par les ineptocrates, le plus simple est d’annuler tout ou partie de la dette de l’état français, par exemple, et de la remplacer par une reconnaissance de dette ne donnant droit à aucun remboursement mais simplement au versement d’une rente de 1.5 % tant que le détenteur est en vie.

C’est donc dire que le but essentiel de tous ces malfaisants va être maintenant de s’attaquer au droit de propriété soubassement ultime des systèmes démocratiques, ce qui implique un certain nombre de conséquences.

  1. Interdiction du cash
  2. Destruction des monnaies pour liquider la dette étatique.
  3. Diabolisation de tous les élus (Orban, Trump, Salvini, Dutertre etc…) n’acceptant pas le « projet » que nos ineptocrates transnationaux ne dissimulent même pas.
  4. Excommunication et mise au pas de tous les intellectuels qui ne pensent pas comme eux.
  5. Fermeture des librairies. Interdiction d’un certain nombre de livres ou d’émissions qui sont brûlés en place publique.
  6. Destruction des commerçants indépendants, qui tendent à soutenir les populistes et le droit de propriété.
  7. Faillite des propriétaires de logements qui seront tous squattés sans vergogne par les représentants de la classe des gens ne produisant rien mais ayant tous les droits.
  8. Instauration d’un salaire versé à tout un chacun dans la population quel que soit ses mérites ou ses efforts.
  9. Euthanasie des vieux dans les maisons de vieillesse (ce qui a bien commencé lors de la crise du covid).
  10. Interdiction des cultes et des rassemblements pour des raisons sanitaires.

Le lecteur remarquera sans effort que toutes ces dispositions, même les plus farfelues sont d’ores et déjà en place.

Ma conclusion est donc toute simple : l’attaque que je sentais arriver depuis des années contre nos libertés fondamentales est lancée et bien lancée et le combat fait rage aux USA entre Trump et la classe des ineptocrates criminels.

Les citoyens américains ont bien de la chance, eux ils peuvent s’armer.

Auteur: Charles Gave

Economiste et financier, Charles Gave s’est fait connaitre du grand public en publiant un essai pamphlétaire en 2001 “ Des Lions menés par des ânes “(Éditions Robert Laffont) où il dénonçait l’Euro et ses fonctionnements monétaires. Son dernier ouvrage “Sire, surtout ne faites rien” aux Editions Jean-Cyrille Godefroy (2016) rassemble les meilleurs chroniques de l’IDL écrites ces dernières années. Il est fondateur et président de Gavekal Research (www.gavekal.com).

Le confinement en question : des professionnels de santé posent un regard différent

Un montage vidéo d’Eric Remacle

La preuve de l’immunité collective en quelques graphiques

Lettre Santé Corps Esprit de Xavier Bazin du 25 novembre 2020.

Cher(e) ami(e) de la Santé,
Il n’y a strictement plus aucune bonne raison de confiner, en FranceLe confinement cause des dégâts économiques majeurs et des ravages sur la santé mentale des Français.Les avantages ? Il n’y en a aucun, en ce moment.Sur LCI, le journalise David Pujadas a eu l’honnêteté de l’expliquer clairement.Regardez la vidéo, elle dure 2 minutes et en vaut la peine :https://www.youtube.com/watch?v=Po1cGksY40c
Son premier argument est celui-ci: le pic des contaminations a eu lieu le 2 novembre, soit le 4ème jour seulement du confinement. Impossible, donc, que la baisse puisse être causée par le confinement, qui prend toujours plus de temps à faire son œuvre.Il suffit de regarder ce qui s’est passé en mars-avril dernier : le confinement n’a absolument pas enrayé l’épidémie, qui a mis encore plus de 2 semaines à atteindre son pic :
Mars avril
D’ailleurs, déjà au printemps dernier, il n’y avait pas de preuve que la décrue était seulement liée au confinement. Car la Suède a aussi atteint son pic épidémique à peu près au même moment, en avril, alors qu’elle a refusé de confiner sa population ! En voici la preuve, avec le nombre de morts de mars à juillet en Suède :
Nombre de morts Suède
Donc, ce n’est pas le confinement qui explique le recul spectaculaire du nombre de cas et d’hospitalisations. Du coup, certains au gouvernement aimeraient nous faire croire que cette décrue est liée au couvre-feu. C’est assez étrange d’imaginer qu’une mesure aussi « faible » pourrait avoir un impact aussi fort. Mais si vous aviez un doute, sachez que la baisse a été la même dans les communes frappées par le couvre-feu et dans celles qui n’étaient pas concernées !
Donc, le couvre-feu n’y est pour rien. Alors pourquoi cette baisse ? D’où vient-elle ? Et d’ailleurs, pourquoi étions-nous nombreux à l’avoir anticipée, en disant que reconfiner était inutile ?
La raison tient en deux mots : immunité collective. Regardez ce qui se passe dans le grand Est et en Ile de France. Si cette deuxième épidémie ne m’a jamais inquiétée, c’est parce que j’avais les yeux rivés sur ce qui se passait en Ile de France et dans le Grand Est, les deux régions les plus touchées en mars-avril. Or depuis le début de l’automne, je vois que les chiffres sont bons, dans ces deux régions. La semaine dernière, le Canard Enchaîné a fini par publier un article sur ce phénomène :« En octobre, avant même le couvre-feu et le reconfinement, les experts avaient constaté que le nombre d’infections et d’hospitalisations augmentait moins vite en Ile de France que presque partout ailleurs sur le territoire. La capitale et sa banlieue affichaient alors des taux d’incidence du virus presque deux fois inférieurs à ceux de Lyon, des deux Savoie ou de Saint-Etienne, qui avaient été pratiquement épargnés au printemps ».
Et le journal enfonce le clou :« Le phénomène s’est révélé plus frappant encore dans Paris intra-muros, qui, avec la Seine-Saint-Denis, a été la zone francilienne la plus touchée en mars et en avril.La baisse atteignait déjà 20 % le 2 novembre, et le phénomène continue depuis dans la ville la plus dense d’Europe, terrain de jeu idéal pour le coronavirus.La diminution, en revanche, apparaît plus faible au sein de la grande couronne moins peuplée et moins atteinte au printemps. »
Sans immunité collective, Paris, dense et très peuplée, aurait dû être lourdement frappée par la deuxième épidémie. Et pourtant, ce n’est pas le cas.

A l’inverse, les départements d’Ile-de-France moins touchés par l’épidémie au printemps auraient dû être davantage épargnés… et c’est le contraire qui s’est produit !Selon le Canard enchaîné, même le Pr Delfraissy, le très pessimiste président du Conseil scientifique, commence à envisager sérieusement l’hypothèse de l’immunité collective.
Mais pour moi, c’est plus qu’une hypothèse : c’est la seule explication possible à ce qu’on observe.
Regardez bien la forme des courbes d’hospitalisations en Ile de France et le grand Est, entre mars et aujourd’hui :
A gauche, on voit le pic épidémique de mars-avril, et à droite, une vague trois fois moins haute à l’automne. C’est le signe clair que ces deux régions largement touchées au printemps sont désormais relativement protégées contre une explosion des hospitalisations. Maintenant, regardez ce qui s’est passé en Rhône-Alpes et PACA, deux régions beaucoup moins touchées au printemps : c’est l’inverse !
Dans ces deux régions épargnées au printemps, la deuxième épidémie a causé deux fois plus d’hospitalisations que la première ! On ne peut pas avoir meilleure preuve de l’immunité collective.
Et la bonne nouvelle, c’est que le virus a désormais circulé largement, partout en France. Donc si on a une troisième épidémie en janvier prochain ou en octobre 2021, l’impact à attendre dans tout le pays sera logiquement encore plus faible que celui, très modéré, qu’on observe en ce moment en Ile-de-France et dans le grand Est. Même phénomène entre la Suède et la République Tchèque.
On observe les mêmes courbes inversées entre la Suède, qui n’a jamais confiné, et la République tchèque, qui s’est barricadée en mars-avril. En Suède, la deuxième épidémie fait peu de morts en ce moment, parce que l’immunité collective a commencé à jouer.
En République tchèque, au contraire, le pays a réussi à étouffer dans l’œuf l’épidémie au printemps, en fermant radicalement ses frontières… mais n’a rien pu faire à l’automne :
Vous noterez au passage qu’en Suède comme en République tchèque, la décrue de l’automne a commencé à peu près au même moment, comme dans tous les pays européens. Alors que ces pays ont des politiques de confinement et de masque très différentes ! Confinement ou pas confinement, l’épidémie est en décrue partout en Europe.
Même chose en Belgique : là-bas, la décrue est spectaculaire, et ne peut pas être liée au confinement, qui a été décidé après le pic épidémique :
Belgique
Et on observe le même phénomène dans les grandes capitales européennes, à Londres ou Rotterdam.Conclusions : RÉ-OUVRONS LE PAYS, VITE ! Tout ceci montre deux choses assez clairement : Les mesures comme le confinement ne peuvent pas grand-chose sur la dynamique de l’épidémie. Il est donc inutile de confiner, et il faut arrêter le massacre tout de suite.
Et surtout, on peut être très optimiste pour la suite ! Avec cette deuxième épidémie, les régions françaises comme PACA et Rhône-Alpes sont désormais au moins aussi bien « protégées » que l’Ile de France ou le Grand Est ! Cela veut dire qu’en cas de recrudescence prochaine, le système hospitalier ne sera pas engorgé – comme il a bien résisté cet automne à Paris, en Seine-Saint-Denis ou en Alsace. Il n’y a donc plus AUCUNE raison de priver les Français de leurs libertés fondamentales. Et il n’y a plus AUCUNE raison de vouloir les vacciner massivement, encore moins de force. Mais évidemment, vu les milliards déjà dépensés pour les vaccins, et le lobbying de Big Pharma, cela va causer de grosses tensions dans les mois qui viennent.
On en reparle très bientôt.
Bonne santé,
Xavier Bazin

Voir aussi l’article de France Soir: Deuxième vague conséquence directe du premier confinement

Un autre montage vidéo d’Eric Remacle sur les tests PCR

Élections aux USA : lettre du général français Dominique Delawarde à ses amis

Mes chers amis,

Nombre d’entre vous m’ont demandé quel était mon opinion sur les événements qui se sont déroulés aux USA entre le 3 novembre et ce jour dans le cadre de l’élection présidentielle américaine. Ma double casquette d’expert du renseignement et de spécialiste des États-Unis m’a valu de nombreuses questions que je résumerai en deux grandes séries :

1 – Y-a-t-il eu fraude électorale et l’hypothèse d’un coup d’état visant à inverser le résultat de l’élection est -elle crédible ?
2 – Si Biden devait être élu le 8 décembre prochain et intronisé le 20 janvier 2021, quelles conséquences faudrait-il attendre de sa prise de pouvoir.

Je vais m’efforcer de répondre clairement à ces deux questions dans les lignes qui suivent.

Lire la suite …

Très belle lettre ouverte au ministre belge de la santé.

Ce courrier a été envoyé ce 17 novembre par Annes Bouria au ministre de la Santé et également transmis à Éliane Tillieux, présidente de la Chambre des représentants.

« Monsieur le Ministre fédéral en charge de la santé publique,

Dans le cadre d’une interpellation purement citoyenne, permettez-moi de vous solliciter en vue d’obtenir des réponses aux questions relatives aux articles en annexe à la présente et concernant la mise en perspective des chiffres sur la covid en Belgique.

  1. Qu’ont concrètement mis en place les autorités fédérales en ce qui concerne les moyens hospitaliers pour faire face à la situation de “2eme vague” qu’elles redoutaient tant depuis plus de 6 mois ?
  2. Pourquoi n’existe-t-il absolument aucune politique de prise en charge des patients atteints de la covid en ambulatoire (hors hospitalisation) ? Cette politique de non prise en charge ne serait-elle pas, entre autres, à l’origine de la sur-fréquentation hospitalière covid, et à fortiori de la surmortalité covid ?
  3. Au vu de la fiabilité discutable en terme diagnostic des tests PCR de détection du SARS-Cov2, des patients admis et répertoriés « covid », sont-ils tous malades à cause d’une infection au SARS-COV2, ou certains sont-ils victimes d’autres infections respiratoires tout en étant porteurs du SARS-COV2 sans que ce dernier soit la cause majeure de leur état clinique ? Idem pour les décès classés “covid”, peut- on affirmer avec certitude que les décès “covid” ont bien tous pour origine majeure une infection au Sars-Cov2 ?
  4. S’il est communément admis qu’il s’écoule généralement un délai de 10 à 15 jours entre des mesures sanitaires prises pour limiter la propagation du Sars-Cov2 et ses effets escomptés, comment prouver l’efficacité de ce nouveau confinement sur l’évolution de l’épidémie sachant que, comme il est démontré dans l’article, le pic de cet épisode épidémique fut atteint aux alentours du 25 octobre ? Quelles sont les preuves scientifiques en terme d’efficacité des mesures de confinement sur la mortalité générale ? Pourquoi n’avoir jamais évalué sérieusement la balance risque/bénéfice de la stratégie de confinement, tant en matière médicale que socio-économique ?
  5. S’il semble très probable que le SARS-Cov2 prenne une tendance à la saisonnalité et qu’une variante particulière du SARS-Cov2 (le variant4) soit à l’origine de ce pic épidémique d’automne, pourquoi maintenir une dialectique de culpabilisation du citoyen rendant ce dernier principalement responsable, par ses comportements, de la situation, alors que cet épisode automnal traduit une évolution classique, identifiable et quantifiable de la dynamique d’une épidémie virale ? Pourquoi maintenir la même politique sanitaire pour une infection virale qui a vu son taux de létalité apparent divisé par 5 au cours des 6 derniers mois dans notre pays (15,7 % au 31 Mai 2020 contre 2,8 % à ce jour) ?
  6. Dans le cadre des éventuelles futures campagnes de vaccination que votre législature semble pressée d’engager, pouvez-vous garantir à chaque citoyen le droit au consentement éclairé ainsi qu’au refus de se voir administrer ce vaccin à la technologie inédite, et ce, en vertu de la loi sur les droits des patients du 22 aout 2002, du respect de l’article 23 de la constitution et du code de Nuremberg ?
  7. Enfin, quelle est la légitimité constitutionnelle des mesures sanitaires prises récemment ? Les membres de votre gouvernement sont-ils conscients des conséquences lourdes sur le plan des libertés fondamentales ainsi que sur la pérennité d’un état de droit démocratique ?

Dans l’attente de vous lire, je vous remercie d’avance pour l’attention que vous porterez à cette requête et vous prie d’accepter, Monsieur le Ministre, l’expression de ma haute considération.

Annes Bouria – Pharmacien
Membre du Collectif interprofessionnel Transparence-Coronavirus pour l’objectivité de l’information et la liberté thérapeutique. »

Source: journal KAIROS, journal belge antiproductiviste et pour une société décente

Avis de tempête sur les élections présidentielles américaines

Ca y est! Les USA entrent dans une période très troublée. Sidney Powell, ancienne procureure et avocate du camp Trump, a rassemblé tous les éléments pour faire invalider les élections américaines notamment pour un logiciel de comptage des votes truqués et d’origine étrangère. Pour rappel, Donald Trump avait publié un « executive order » en 2018, suite à l’affaire Russian Gate de l’élection précédente, pour décréter un état d’urgence de sécurité pour contrer toute influence étrangère dans les élections américaines. Cet état d’urgence est toujours d’application pour ces élections présidentielles et devrait permettre enquêtes et arrestations de toutes les personnes ou sociétés incriminées. Ceci peut être considéré comme une déclaration de guerre à l’état profond (CIA, Soros, milliardaires des Big Tech et Big Pharma, …).
Voir ci-dessous la vidéo de la déclaration de Sydney Powell ce 19/11.

Covid-19: politisation, «corruption» et suppression de la science

Editorial publié dans sa propre revue par Kamran Abbasi, rédacteur en chef de la revue scientifique BMJ (British Medical Journal)

Quand la bonne science est supprimée par le complexe médico-politique, les gens meurent.

Les politiciens et les gouvernements suppriment la science. Ils le font dans l’intérêt public, disent-ils, pour accélérer la disponibilité des diagnostics et des traitements. Ils le font pour soutenir l’innovation, pour mettre des produits sur le marché à une vitesse sans précédent. Ces deux raisons sont en partie plausibles; les plus grandes déceptions sont fondées sur un grain de vérité. Mais le comportement sous-jacent est troublant.

La science est supprimée à des fins politiques et financières. Covid-19 a déclenché la corruption de l’État à grande échelle et est néfaste pour la santé publique.  Les politiciens et l’industrie sont responsables de ce détournement de fonds opportuniste. Il en va de même pour les scientifiques et les experts en santé. La pandémie a révélé comment le complexe médico-politique peut être manipulé en cas d’urgence – un moment où il est encore plus important de sauvegarder la science.

La réponse pandémique du Royaume-Uni fournit au moins quatre exemples de suppression de la science ou des scientifiques.
Premièrement, la composition, la recherche et les délibérations du Groupe consultatif scientifique pour les urgences (SAGE) étaient initialement secrètes jusqu’à ce qu’une fuite de presse force la transparence.  La fuite a révélé l’ interférence des conseillers gouvernementaux dans SAGE, tout en exposant la sous-représentation de la santé publique, les soins cliniques, les femmes et les minorités ethniques. En effet, le gouvernement a également reçu récemment l’ordre de publier un rapport de 2016 sur les lacunes de la préparation à une pandémie, l’opération Cygnus, à la suite d’un verdict du bureau du commissaire à l’information. 

Ensuite, un rapport de Public Health England sur la covid-19 et les inégalités. La publication du rapport a été retardée par le ministère de la Santé d’Angleterre; une section sur les minorités ethniques a été initialement suspendue puis, à la suite d’un tollé général, a été publiée dans le cadre d’un rapport de suivi.  Les auteurs de Public Health England ont reçu pour instruction de ne pas parler aux médias.

Troisièmement, le 15 octobre, le rédacteur en chef du Lancet s’est plaint qu’un auteur d’un article de recherche, un scientifique du gouvernement britannique, a été empêché par le gouvernement de parler aux médias en raison d’un «paysage politique difficile». 

Maintenant, un nouvel exemple concerne la controverse sur les tests d’anticorps au point de service pour la covid-19.  L’opération Moonshot du Premier ministre dépend de la disponibilité immédiate et généralisée de tests de diagnostic rapide précis.  Il dépend aussi de la logique douteuse de dépistage en masse à l’essai à Liverpool avec un suboptimal test PCR. 

L’incident est lié à une recherche publiée cette semaine par le BMJ , qui révèle que le gouvernement a acheté un test d’anticorps qui, dans les tests du monde réel, est bien en deçà des déclarations de performance faites par ses fabricants. Des chercheurs de Public Health England et des institutions collaboratrices ont raisonnablement poussé à publier les résultats de leur étude avant que le gouvernement ne s’engage à acheter un million de ces tests, mais ont été bloqués par le ministère de la Santé et le bureau du Premier ministre.  Pourquoi était-il important de se procurer ce produit sans examen minutieux? La publication préalable de recherches sur un serveur de pré-impression ou sur un site Web gouvernemental est compatible avec le politique de publication de BMJ. Comme pour prouver un point, Public Health England a ensuite tenté en vain de bloquer le communiqué de presse du BMJ concernant le document de recherche.

Les politiciens prétendent souvent suivre la science, mais c’est une simplification excessive trompeuse. La science est rarement absolue. Cela s’applique rarement à tous les milieux ou à toutes les populations. Cela n’a pas de sens de suivre servilement la science ou les preuves. Une meilleure approche consiste pour les politiciens, les décideurs nommés publiquement, à être informés et guidés par la science lorsqu’ils décident des politiques pour leur public. Mais même cette approche ne retient la confiance du public et des professionnels que si la science est disponible pour examen et sans ingérence politique, et si le système est transparent et n’est pas compromis par des conflits d’intérêts.

La répression de la science et des scientifiques n’est ni nouvelle ni un phénomène particulièrement britannique. Aux États-Unis, le gouvernement du président Trump a manipulé la Food and Drug Administration pour approuver à la hâte des médicaments non prouvés tels que l’hydroxychloroquine et le remdesivir. Globalement, les gens, les politiques et les marchés sont corrompus par les agendas politiques et commerciaux. 

La réponse du Royaume-Uni à la pandémie repose trop fortement sur des scientifiques et d’autres personnes nommées par le gouvernement aux intérêts concurrents inquiétants, y compris des participations dans des entreprises qui fabriquent des tests de diagnostic, des traitements et des vaccins covid-19.  nommées par le gouvernement sont en mesure d’ignorer ou de faire des choix scientifiques spécieux une autre forme d’abus et se livrer à des pratiques anticoncurrentielles qui favorisent leurs propres produits et ceux des amis et associés. 

Comment la science pourrait-elle être sauvegardée en ces temps exceptionnels? La première étape est la divulgation complète des intérêts concurrents du gouvernement, des politiciens, des conseillers scientifiques et des personnes nommées, tels que les responsables des tests et du traçage, de l’approvisionnement en tests diagnostiques et de la livraison des vaccins. La prochaine étape est la transparence totale des systèmes de prise de décision, des processus et de savoir qui est responsable de quoi.

Une fois que la transparence et la responsabilité sont établies en tant que normes, les personnes employées par le gouvernement ne devraient idéalement travailler que dans des domaines sans rapport avec leurs intérêts concurrents. L’expertise est possible sans intérêts concurrents. Si une règle aussi stricte devient irréalisable, la bonne pratique minimale est que les personnes ayant des intérêts concurrents ne doivent pas être associées aux décisions relatives aux produits et aux politiques dans lesquelles elles ont un intérêt financier.

Les gouvernements et l’industrie doivent également cesser d’annoncer une politique scientifique critique par communiqué de presse. De telles mesures mal jugées laissent la science, les médias et les marchés boursiers vulnérables à la manipulation. Une publication claire, ouverte et préalable des bases scientifiques de la politique, des achats et des médicaments miracles est une exigence fondamentale. 

Les enjeux sont élevés pour les politiciens, les conseillers scientifiques et les personnes nommées par le gouvernement. Leur carrière et leurs soldes bancaires peuvent dépendre des décisions qu’ils prennent. Mais ils ont une responsabilité et un devoir plus élevés envers le public. La science est un bien public. Il n’est pas nécessaire de le suivre aveuglément, mais il faut en tenir compte de manière équitable. Il est important de noter que la suppression de la science, que ce soit en retardant la publication, en sélectionnant des recherches favorables ou en bâillonnant les scientifiques, est un danger pour la santé publique, causant des décès en exposant les gens à des interventions dangereuses ou inefficaces et en les empêchant de bénéficier de meilleures. Lorsqu’il est mêlé à des décisions commerciales, il s’agit également d’une mauvaise administration de l’argent des contribuables.

La politisation de la science a été déployée avec enthousiasme par certains des pires autocrates et dictateurs de l’histoire, et elle est malheureusement courante dans les démocraties.  Le complexe médico-politique tend vers la suppression de la science pour agrandir et enrichir ceux qui sont au pouvoir. Et, à mesure que les puissants gagnent en succès, s’enrichissent et s’enivrent davantage de pouvoir, les vérités peu pratiques de la science sont supprimées. Lorsque la bonne science est supprimée, les gens meurent.

Lien vers l’article en anglais avec toutes les références

COVID19 – Preuve d’une fraude mondiale !

Lien vers l’article original du site OffGuardian.org avec tous les liens

Iain Davis

Le COVID 19 et les réponses gouvernementales ultérieures semblent faire partie d’un complot international en vue de commettre une fraude. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SARS-CoV-2 provoque une maladie appelée COVID 19.

Parfois, vous devez suivre votre instinct. Je ne suis pas un expert en génétique et, comme toujours, je dois être corrigé. Cependant, mon attention a été attirée sur certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur  conseil consultatif, composé  de médecins et de scientifiques éminemment qualifiés, confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction en anglais (voir le précédent article de eveilinfo.org avec la traduction en français )  de leur rapport et je  peux corroborer l’exactitude de leurs affirmations concernant les séquences nucléotidiques répertoriées dans les protocoles de l’Organisation mondiale de la santé. Vous pouvez faire la même chose.

D-Salud-Discovery indique qu’il n’y a pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé du COVID 19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de COVID 19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de celui-ci.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve d’une pandémie, simplement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, autre que les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société en fonction de leurs objectifs.

Ce faisant, cette  «classe de parasites»  a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’enquêtes et de poursuites devant un tribunal.

IDENTIFICATION DE QUOI EXACTEMENT?

L’Organisation mondiale de la santé (OMS) a  classé le COVID-19  (COronaVIrus Disease 2019). Ils ont déclaré une pandémie mondiale de COVID 19 le 11 mars 2019.

Les directives de l’OMS sur les  analyses de laboratoire  stipulent:

L’agent étiologique [causalité de la maladie] responsable du groupe de cas de pneumonie à Wuhan a été identifié comme un nouveau bêtacoronavirus, (dans la même famille que le SRAS-CoV et le MERS-CoV) via le séquençage de nouvelle génération (NGS) à partir du virus de culture ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie. »

L’OMS affirme que le virus SRAS-CoV-2  provoque la maladie COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de situation 1 sur le nouveau coronavirus 2019-nCov de l’OMS  , ils déclarent:

Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 …… Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays l’utilisent dans le développement de kits de diagnostic spécifiques.

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour étude), puis des séquences génétiques ont été  identifiées à  partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été développés et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et des chercheurs chinois, ces tests permettront de trouver le virus responsable du COVID 19.

Pourtant, l’OMS déclare également:

Travaillant directement à partir des informations de séquence, l’équipe a développé une série de tests d’amplification génétique (PCR) utilisés par les laboratoires. »

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des  «informations de séquence»  car il n’y avait pas d’échantillon isolé et purifié du virus dit SARS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines hérissée contenant l’ARN viral).

Cependant, ces structures protéiques ne sont  pas uniques . Ils ressemblent à d’autres vésicules rondes, telles que les vésicules endocytaires et les exosomes.

Les virologues affirment qu’il n’est pas possible d ‘  «isoler»  un virus car ils ne se répliquent qu’à l’intérieur des cellules hôtes. Ils ajoutent que  les postulats de Koch  ne s’appliquent pas parce qu’ils concernent des bactéries (qui sont des organismes vivants). Au lieu de cela, les virologues observent les effets cytopathogènes (CPE) du virus, provoquant la mutation et la dégradation des cellules, dans les cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé pour  la première fois le génome complet du SRAS-CoV-2, ils ont observé le CPE dans les cellules Vero E6 et Huh7. Vero E6 est une lignée cellulaire de singe immortalisée et Huh7 sont des cellules cancéreuses immortalisées (tumorigènes). Cela signifie qu’ils ont été maintenus in vitro (dans des cultures de boîtes de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 est l’idée qu’il s’agit d’un virus zoonotique, capable de combler le fossé des espèces entre les animaux et les humains. Lorsque des  scientifiques du CDC américain ont  «infecté»  diverses cellules avec le nouveau virus, ils ont noté ce qui suit:

Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires de primates et humaines communes, y compris les cellules d’adénocarcinome humain (A549) [cellules pulmonaires], les cellules hépatiques humaines (HUH7.0) et les cellules rénales embryonnaires humaines ( HEK-293T), en plus de Vero E6 et Vero CCL81 [cellules de singe]… Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires sauf dans les cellules Vero [cellules de singe]… Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et Les cellules A549 [cellules du tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2. »

Le CDC n’a observé aucun CPE dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, suggérant qu’une infection d’un humain à l’autre serait impossible.

Notant ce problème, une équipe de scientifiques polonais a introduit ce «virus» séquencé   dans  les cellules de l’épithélium humain (voies respiratoires) . Ils ont observé les effets sur ces cultures d’AOH pendant 5 jours. Ils ont noté une réplication beaucoup plus grande que les scientifiques du CDC, mais ont finalement déclaré:

«Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’AOH.»

Cela signifie qu’ils n’ont vu aucune preuve des virions supposés rompant la membrane de la paroi cellulaire. Encore une fois, suggérant que ce soi-disant virus n’est pas infectieux chez l’homme.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer des maladies. Cela peut même ne pas exister physiquement. N’est-ce rien d’autre qu’un concept basé sur   des séquences génétiques prédictives ?

VOYAGE DE DÉCOUVERTE

Le Centre de contrôle et de prévention des maladies de Wuhan et le Centre clinique de santé publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2  (MN908947.1). Cela a été mis à jour plusieurs fois. Cependant, MN908947.1 était la première séquence génétique décrivant l’ agent étiologique présumé du COVID 19   (SARS-CoV-2).

Toutes les déclarations, tests, traitements, statistiques, développement de vaccins et politiques qui en résultent sont basés sur cette séquence. Si les tests pour ce  nouveau  virus n’identifient rien de capable de provoquer des maladies chez les êtres humains, tout le récit du COVID 19 n’est rien d’autre qu’une mascarade.

Les  chercheurs de WUHAN ont déclaré  qu’ils avaient effectivement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques, découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé un  assemblage de novo  et une PCR ciblée et ont trouvé 29 891 paires de bases partageant une correspondance de séquence de 79,6% avec le SARS-CoV.

Ils ont dû utiliser l’  assemblage de novo  parce qu’ils n’avaient aucune  connaissance a  priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle des chercheurs chinois ont  isolé  le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome du coronavirus du SRAS publié (SARS-CoV). Malheureusement, la précision du génome original du SRAS-CoV n’est pas non plus claire.

En 2003, une équipe de  chercheurs de Hong Kong a  étudié 50 patients atteints du syndrome respiratoire aigu sévère (SRAS). Ils ont prélevé des échantillons de 2 de ces patients et ont développé une culture dans des cellules hépatiques de singe foetal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques  «d’origine inconnue».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il appartenait à la famille des Coronaviridae. Considérant que ces séquences suggéraient un virus SARS-CoV nouvellement découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré:

Les amorces de détection du nouveau virus ont été conçues pour la détection par RT-PCR de ce génome de coronavirus humain associé à la pneumonie dans des échantillons cliniques. Sur les 44 échantillons de nasopharynx disponibles auprès des 50 patients atteints du SRAS, 22 présentaient des preuves d’ARN de coronavirus humain associé à la pneumonie.

La moitié des patients testés, qui présentaient tous les mêmes symptômes, ont été testés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce  nouveau  virus SRAS-CoV. La question n’a pas été posée.

Ce virus supposé n’avait qu’une correspondance de séquence de 57% avec le coronavirus prétendument connu. Les 43% restants étaient simplement  «là».  Les données séquencées ont été produites et enregistrées en tant que nouveau génome sous le numéro d’ accès GenBank  AY274119 .

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SARS-CoV (2019-nCoV – finalement renommée SARS-CoV-2). Personne, à aucun stade de ce processus, n’avait produit d’échantillon isolé et purifié de quelque virus que ce soit. Tout ce qu’ils avaient était des correspondances de séquence de pourcentage avec d’autres correspondances de séquence de pourcentage.

N’ISOLER RIEN

Les scientifiques sont très ennuyés car ils n’arrêtent pas de dire que le virus a été isolé mais personne ne les croit. C’est parce que, pour l’instant, personne n’a fourni un seul échantillon purifié du virus SARS-CoV-2. Ce que nous avons à la place est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images de virions du SRAS-C0V-2 de confirmer qu’il s’agissait d’images d’un virus isolé et purifié. Aucun d’eux ne le pouvait .

En Australie, des scientifiques du  Doherty Institute ont annoncé avoir  isolé  le virus SARS-CoV-2 . Lorsqu’on leur a demandé de clarifier les choses, les scientifiques ont déclaré:

«Nous avons des séquences courtes (ARN) du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic»

Cela explique pourquoi le  gouvernement australien  déclare:

La fiabilité des tests COVID-19 est incertaine en raison de la base de preuves limitée… Il existe des preuves limitées disponibles pour évaluer l’exactitude et l’utilité clinique des tests COVID-19 disponibles.

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a  écrit une lettre  au Premier ministre britannique Boris Johnson dans laquelle ils lui ont demandé de:

Produire des preuves scientifiques examinées par des pairs de manière indépendante prouvant que le virus Covid-19 a été isolé. »

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a  adressé une demande d’accès à l’information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. À quoi  ils ont répondu :

PHE peut confirmer qu’il ne contient pas d’informations de la manière suggérée par votre demande. « 

La chercheuse canadienne Christine Massey a fait une demande similaire d’accès à l’information, demandant la même chose au gouvernement canadien. À quoi le  gouvernement canadien a répondu :

Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu localiser aucun document répondant à votre demande. »

Aux États-Unis, le panneau de diagnostic RT-PCR du Center for Disease Control (CDC)   indique:

… Aucun isolat viral quantifié du 2019-nCoV n’est actuellement disponible …… .. La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent causal des symptômes cliniques. »

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur de tout patient déclaré atteint de la maladie du COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou provoque le COVID 19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Voir aussi: Dr. Tom Cowan w/ Jon Rappoport: SARS-CoV-2 Has Never Been Isolated, Is Only an Imaginary or Theoretical Virus, and, Therefore, No Test Can Detect It

TESTER POUR RIEN

L’OMS, et chaque gouvernement, groupe de réflexion, comité directeur des politiques, conseiller scientifique du gouvernement, institutions supranationales et autres qui promeuvent le récit officiel du COVID 19, affirment que le SRAS-CoV-2 cause le COVID 19.

Bien que personne n’ait jamais produit un échantillon de ce supposé virus, le génome présumé du SRAS-CoV-2  a été publié . C’est dans le domaine public.

On dit que les séquences génétiques clés  du génome du SRAS-CoV-2 ont des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour  identifier  la présence du  «virus» . 

  • Ceux-ci incluent:
    • Gène ARN-polymérase (Rd-Rp) – Cela permet à l’ARN du SARS-CoV-2 de se répliquer à l’intérieur du cytoplasme des cellules épithéliales atteintes de COVID 19.
    • Gène S (Orf2) – cette glycoprotéine forme le pic sur la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 sur les cellules, permettant à l’ARN à l’intérieur de l’enveloppe de la protéine du virion (capside) de passer dans la  cellule maintenant  infectée .
    • Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage viral
    • Gène N (Orf9a) – le gène de la nucléocapside qui lie l’ARN dans la formation de la capside

L’OMS tient un  registre accessible au public  des amorces et sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences nucléotidiques spécifiques qui se lient (s’hybrident) aux brins antisens et sens de l’ADNc synthétisé (appelées respectivement amorces sens et inverse).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences nucléotidiques appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Lors de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, la sonde se désintègre en libérant un fluorescent ou un colorant qui peut ensuite être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

L’ outil de recherche d’alignement local de base  (BLAST) est un autre élément accessible au public  . Cela permet à quiconque de comparer les séquences nucléotidiques publiées avec toutes celles stockées par la base de données génétique des National Institutes of Health (NIH) des États-Unis appelée GenBank. Par conséquent, nous pouvons BLASTER les amorces, sondes et séquences de gènes cibles du SRAS-CoV-2 revendiquées.

Les protocoles d’amorces et de sondes sens et inverses de l’OMS pour le génome viral présumé du SRAS-CoV-2 sont basés sur les profils de gènes RdRp, Orf1, N et E. N’importe qui peut les exécuter via BLAST pour voir ce que nous trouvons.

La séquence nucléotidique vitale RdRP, utilisée comme amorce sens est – ATGAGCTTAGTCCTGTTG. Si nous exécutons un nucléotide BLAST, celui-ci est enregistré comme un isolat  complet de SARS-CoV-2  avec une identité de séquence à 100%. De même, la séquence d’amorce du gène E inverse – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui  identifie également  SARS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences nucléotidiques des génomes microbiens et humains. Si nous recherchons la séquence RdRp SARS-CoV-2, elle révèle 99 chromosomes humains avec une correspondance d’identité de séquence à 100%. L’Orf1ab (gène E) renvoie 90 avec une correspondance d’identité de séquence de 100% avec les chromosomes humains.

Faire de même pour ces séquences avec une recherche microbienne trouve 92 microbes avec une correspondance à 100% avec le gène SARS-CoV-2 E et 100 microbes correspondants, avec une identité de séquence à 100%, avec le gène vital SARS-CoV-2 RdRp.

Chaque fois que nous vérifions les marqueurs génétiques dits uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, censées identifier le SRAS-CoV-2, ne sont pas uniques. Il peut s’agir de n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les  soi- disant  vérificateurs de faits , comme le  projet Health Feedback de Reuters  , ont rapidement rejeté les affirmations de  ceux qui ont remarqué le manque apparent de spécificité dans le génome supposé du SRAS-CoV-2.

En utilisant une multitude d’arguments d’homme de paille comme,  «cette affirmation suggère que chaque test devrait être positif»  (ce qui n’est pas le cas), leur   tentative de  démystification exécute quelque chose comme ceci :

Les amorces sont conçues pour se lier à des séquences nucléotidiques spécifiques qui sont uniques au virus. L’amorce sens peut se lier à un chromosome particulier, mais l’amorce inverse ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SARS-CoV-2. De plus, parce que les amorces sens et pervers enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble délibérément déformer la signification de ces conclusions en transmettant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches BLAST montrent que ces séquences cibles ne sont pas uniques au SARS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont  enquêté sur l’épidémiologie  des cas présumés marocains   de SRAS-CoV-2. Neuf pour cent étaient positifs pour trois gènes, dix-huit pour cent étaient positifs pour deux gènes et soixante-treize pour cent pour un seul. Comme nous venons de le dire, beaucoup peuvent avoir été positifs pour aucun.

Ceci est entièrement conforme aux  directives de test de l’OMS . Ils déclarent:

«Un diagnostic optimal consiste en un NAAT [test d’amplification d’acide nucléique] avec au moins deux cibles indépendantes du génome du SRAS-CoV-2; cependant, dans les régions où la transmission est répandue, un algorithme simple à cible unique peut être utilisé… Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2. »

Indépendamment des arguments fallacieux des vérificateurs de faits bien financés  ,  si les amorces avant et arrière identifient des indésirables, peut-être l’un étant le fragment d’un chromosome et l’autre une séquence microbienne, alors la région amplifiée entre eux est probablement également indésirable.

L’argument selon lequel la RT-PCR ne trouve que l’ARN est spécieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression génique. Personne ne dit que des chromosomes entiers ou des microbes sont séquencés dans le génome présumé du SRAS-CoV-2. Bien qu’ils puissent, pour tout ce que nous savons. Ils disent que les marqueurs présumés, utilisés pour tester ce supposé virus, ne sont pas adaptés.

Les tests RT-PCR ne séquencent pas le génome entier. Ils recherchent des incidents de fluorescence de sonde spécifique pour indiquer la présence de séquences dites exister. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et sondes ne pouvaient rien révéler d’autre que des correspondances d’ARN extraites d’  ADN non codant, parfois appelé  «indésirable», ADN (ADNc).

Par exemple, le  gène SARS-CoV-2 S  est censé être hautement spécifique du génome du virus SARS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité à 100%. La correspondance de pourcentage d’identité la plus faible, parmi les 100 premiers, est de 95%. Un BLAST du génome humain trouve également une correspondance de séquence à 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement ce que c’est. Le génome entier pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve que le SRAS-CoV-2 existe. Par conséquent, il n’y a pas non plus de preuve qu’une maladie appelée COVID 19 existe.

Cela signifie qu’il n’y a aucune base scientifique pour toute allégation concernant le nombre de cas de COVID 19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour  lutter contre  ce  virus mortel  sont très probablement fondées sur rien.

FRAUDE CONCLUANTE

La fraude est un acte criminel. La  définition juridique  de la fraude est:

«Une pratique frauduleuse ou un acte délibéré, auquel on a eu recours avec l’intention de priver un autre de ses droits ou, d’une manière ou d’une autre, de lui causer des blessures.»

La définition légale d’un complot est:

« Une combinaison ou une confédération entre deux ou plusieurs personnes constituées en vue de commettre, par leurs efforts conjoints, un acte illégal ou criminel »

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont fourni aucune preuve pour montrer qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID 19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut le lire.

Pour qu’il y ait fraude, la tromperie doit être volontaire. L’intention doit être de priver délibérément autrui de ses droits ou de lui porter atteinte d’une autre manière. S’il existe des preuves de collusion entre des individus et / ou des organisations pour commettre une fraude, il s’agit alors d’un complot (dans les juridictions de common law) ou d’une  entreprise criminelle commune  (ECC) en vertu du droit international.

Il semble que COVID 19 a été délibérément utilisé comme  casus belli  pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté d’errer restreinte, la liberté de parole et d’expression érodée, les droits de manifester restreints, séparés de nos proches, nos entreprises détruites, psychologiquement bombardées, muselées et terrorisées.

Pire encore, bien qu’il n’y ait  aucune preuve  de   mortalité toutes causes sans précédent , il y a eu des pics de décès non saisonniers. Celles-ci  correspondent précisément aux mesures de verrouillage  qui ont vu le retrait des services de santé pour lesquels nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire du COVID 19 proposent que cette prétendue maladie justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’  humanité elle-même .

Pour être  autorisés  à participer à leur soi-disant  «nouvelle normalité»,  qui est la transformation globale de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci incluent, mais sans s’y limiter, la surveillance bio-métrique de tout le monde, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une revendication effective que nous n’avons pas droit à la souveraineté sur nos propres organes. Ceci constitue la  condition de l’esclavage .

Il ne fait aucun doute que nous avons été privés de nos droits et lésés. Dans les juridictions de common law, l’innocence est présumée, mais la preuve qu’un préjudice a été délibérément causé par un complot international est accablante. Les politiques destructrices, adoptées par les gouvernements du monde entier, sont clairement nées des groupes de réflexion mondialistes et des institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont collectivement été incapables d’accéder ou de comprendre l’une des preuves librement disponibles suggérant que le COVID 19 est un mythe.

Les responsables du crime de complot en vue de commettre une fraude mondiale devraient être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que nous autres essayons de réparer les dommages qu’ils ont déjà infligés.

Article complémentaire montrant que le virus n’a jamais été isolé.

Encore un article de Réseau International sur le même sujet

Et si le virus n’existait pas ?

Selon l’étude (en anglais) que vous pouvez télécharger ci-dessous, le test PCR ne détecte pas le SRAS-COV2 !

Extraits traduits:

Les séquences génétiques utilisées dans les PCR pour détecter une suspicion de SRAS-CoV-2 et pour diagnostiquer des cas de maladie et de décès attribués au Covid-19 sont présents dans des dizaines de séquences du génome humain lui-même et dans ceux d’une centaine de microbes.
Et cela inclut les initiateurs ou amorces, les fragments les plus étendus pris au hasard de leur supposé « génome » et même les soi-disant « gènes cibles » prétendument spécifiques au « nouveau coronavirus « . Le test est sans valeur et tous les résultats » positifs « obtenus jusqu’à présent devraient être scientifiquement invalidés et communiqués aux personnes concernées; et s’ils sont décédés, leurs proches.
Stephen Bustin, l’un des plus grands experts mondiaux de la PCR, dit en fait que sous certaines conditions, tout le monde peut être testé positif!

En conclusion: La conséquence de tout ce que nous venons d’expliquer est claire et immédiate: IL N’Y A PAS DE TEST VALIDE POUR DÉTECTER LE SARS-COV-2, ni tests d’anticorps ou d’antigènes ni RT-PCR. Et nous avons inclus ceux basés sur le gène supposé qui code pour la protéine S1 ou spike. Et cela signifie que TOUS LES NOMBRES DE «CAS», «INFECTÉ», «MALADE», «Asymptomatique» OU «MORT DUE POUR COVID-19 « MANQUE DE BASE SCIENTIFIQUE ET TOUS LES » POSITIFS « SONT FAUX POSITIFS, quelque chose qui devrait être communiqué immédiatement aux personnes concernées et aux autorités responsables qui devraient en être tenues pour responsables.

Au vu des développements aberrants des mesures prises pour soi-disant lutter contre ce virus, ses deuxième, troisième, … pseudo vagues tous basés sur ce test PCR, je commence sérieusement à me dire que ce virus n’existe pas.

Dans ce sens, il me semble opportun de reprendre ici une vidéo de Jean-Jacques Crèvecoeur du mois de juillet, où il étudiait l’hypothèse que ce virus n’existe pas.

Voir aussi la vidéo de David Icke sur le même thème.

Une étude scientifique danoise conclut à l’inefficacité des masques

Voir aussi en bas d’article d’autres sources et une petite vidéo d’Eric Remacle

Il semble que ceci est la première et seule étude scientifique connue concernant l’efficacité des masques dans la transmission du virus SRAS-COV-2. On ne peut pas dire que cela conforte les impositions gouvernementales de port du masque.

L’étude complète en anglais

Résumé traduit en français:

Efficacité d’ajouter une recommandation de port de masque à d’autres mesures de santé publique pour prévenir l’infection par le SRAS-CoV-2 pour des porteurs danois.


Un essai contrôlé randomisé
Henning Bundgaard, DMSc, Johan Skov Bundgaard, BSc, … Voir tous les auteurs
Auteur, article et divulgation d’informations
https://doi.org/10.7326/M20-6817

Contexte :
Les observations courantes suggèrent que le port du masque atténue la transmission du coronavirus 2 du syndrome respiratoire aigu sévère (SRAS-CoV-2). Il n’est pas certain que cette association observée soit due à la protection des porteurs non infectés (effet protecteur), à la réduction de la transmission par les porteurs de masques infectés (contrôle à la source), ou aux deux.

Objectif :
Évaluer si le fait de recommander l’utilisation de masques chirurgicaux en dehors du domicile réduit le risque d’infection par le CoV-2 du SRAS chez les porteurs dans un contexte où les masques étaient peu courants et ne faisaient pas partie des mesures de santé publique recommandées.

Conception :
Essai contrôlé randomisé (DANMASK-19 [étude danoise pour évaluer les masques de protection contre l’infection par COVID-19]). (ClinicalTrials.gov : NCT04337541)

Le réglage :
Danemark, avril et mai 2020.

Participants :
Adultes passant plus de 3 heures par jour en dehors de la maison sans utiliser de masque professionnel.

Intervention :
Encouragement à suivre les mesures de distanciation sociale pour la maladie à coronavirus 2019, plus soit une recommandation de ne pas porter de masque, soit une recommandation de porter un masque en dehors de la maison parmi d’autres personnes, ainsi qu’une fourniture de 50 masques chirurgicaux et des instructions pour une utilisation correcte.

Mesures :
Le principal résultat est l’infection par le CoV-2 du SRAS chez le porteur du masque à 1 mois par un test d’anticorps, une réaction en chaîne de la polymérase (PCR) ou un diagnostic à l’hôpital. Le résultat secondaire était la positivité de la PCR pour d’autres virus respiratoires.

Résultats :
Au total, 3030 participants ont été assignés au hasard à la recommandation de porter un masque, et 2994 ont été assignés au contrôle ; 4862 ont terminé l’étude.
L’infection par le CoV-2 du SRAS s’est produite chez 42 participants à qui l’on avait recommandé de porter un masque (1,8 %) et chez 53 participants du groupe témoin (2,1 %). La différence entre les groupes était de -0,3 point de pourcentage (IC à 95%, -1,2 à 0,4 point de pourcentage ; P = 0,38) (rapport de cotes, 0,82 [IC, 0,54 à 1,23] ; P = 0,33). L’imputation multiple tenant compte de la perte au suivi a donné des résultats similaires. Bien que la différence observée ne soit pas statistiquement significative, les IC de 95% sont compatibles avec une réduction de 46% à une augmentation de 23% de l’infection.

Limitation :
Résultats non concluants, données manquantes, adhésion variable, résultats des tests à domicile rapportés par les patients, pas d’aveuglement et pas d’évaluation de la capacité des masques à réduire la transmission des maladies des porteurs de masque aux autres.

Conclusion :
La recommandation de porter des masques chirurgicaux en complément d’autres mesures de santé publique n’a pas réduit le taux d’infection par le SRAS-CoV-2 chez les porteurs de masque de plus de 50 % dans une communauté où les taux d’infection sont modestes, où il existe un certain degré de distanciation sociale et où l’utilisation générale des masques est peu courante. Les données étaient compatibles avec un degré moindre d’autoprotection.

Principale source de financement :
Les Fondations Salling.

Traduit avec http://www.DeepL.com/Translator (version gratuite)

Un autre article américain (en anglais) montrant que les masques n’ont pas d’incidence sur les statistiques du covid.

Et encore un autre article en anglais …

Un montage vidéo de Eric Remacle sur les avis de professionnels de santé à propos du port du masque